ID: 1010578313

View in Genome Browser
Species Human (GRCh38)
Location 6:77561793-77561815
Sequence GGTTGGCTTTCCTAAGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010578304_1010578313 21 Left 1010578304 6:77561749-77561771 CCATGTCAGAATGCAGCTTCCCA No data
Right 1010578313 6:77561793-77561815 GGTTGGCTTTCCTAAGGTCAGGG No data
1010578306_1010578313 2 Left 1010578306 6:77561768-77561790 CCCAGGTATACACAGCATCTGAG No data
Right 1010578313 6:77561793-77561815 GGTTGGCTTTCCTAAGGTCAGGG No data
1010578307_1010578313 1 Left 1010578307 6:77561769-77561791 CCAGGTATACACAGCATCTGAGA No data
Right 1010578313 6:77561793-77561815 GGTTGGCTTTCCTAAGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010578313 Original CRISPR GGTTGGCTTTCCTAAGGTCA GGG Intergenic
No off target data available for this crispr