ID: 1010579085

View in Genome Browser
Species Human (GRCh38)
Location 6:77572001-77572023
Sequence GAGTCAGAGCAGAAGGACGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010579085_1010579090 19 Left 1010579085 6:77572001-77572023 CCTACGTCCTTCTGCTCTGACTC No data
Right 1010579090 6:77572043-77572065 TATTAACTGCCACGCTCATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010579085 Original CRISPR GAGTCAGAGCAGAAGGACGT AGG (reversed) Intergenic
No off target data available for this crispr