ID: 1010584751

View in Genome Browser
Species Human (GRCh38)
Location 6:77643927-77643949
Sequence CTGTGTCAAGGAAATGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010584751_1010584756 17 Left 1010584751 6:77643927-77643949 CCCAGATCATTTCCTTGACACAG No data
Right 1010584756 6:77643967-77643989 CAGTGTCACAGTGCAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010584751 Original CRISPR CTGTGTCAAGGAAATGATCT GGG (reversed) Intergenic
No off target data available for this crispr