ID: 1010585819

View in Genome Browser
Species Human (GRCh38)
Location 6:77657885-77657907
Sequence TAGTGTGAACAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010585819_1010585826 25 Left 1010585819 6:77657885-77657907 CCCTCCTCCTCCTGTTCACACTA No data
Right 1010585826 6:77657933-77657955 TCCTTCATAAATGTATAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010585819 Original CRISPR TAGTGTGAACAGGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr