ID: 1010595673

View in Genome Browser
Species Human (GRCh38)
Location 6:77760687-77760709
Sequence CAGGATACACTAATCTAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010595670_1010595673 -7 Left 1010595670 6:77760671-77760693 CCATCATGACCTCTTCCAGGATA 0: 1
1: 0
2: 3
3: 18
4: 209
Right 1010595673 6:77760687-77760709 CAGGATACACTAATCTAACAAGG No data
1010595668_1010595673 11 Left 1010595668 6:77760653-77760675 CCTACTTTATAAGTAGTTCCATC 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1010595673 6:77760687-77760709 CAGGATACACTAATCTAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010595673 Original CRISPR CAGGATACACTAATCTAACA AGG Intronic
No off target data available for this crispr