ID: 1010601007

View in Genome Browser
Species Human (GRCh38)
Location 6:77826504-77826526
Sequence AAGGCTGTACACTTTGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010601007_1010601011 18 Left 1010601007 6:77826504-77826526 CCCTTCTCAAAGTGTACAGCCTT 0: 1
1: 0
2: 0
3: 23
4: 182
Right 1010601011 6:77826545-77826567 CTTCCAAGTGGTAAACCAAATGG No data
1010601007_1010601010 6 Left 1010601007 6:77826504-77826526 CCCTTCTCAAAGTGTACAGCCTT 0: 1
1: 0
2: 0
3: 23
4: 182
Right 1010601010 6:77826533-77826555 ACTTGAAATATGCTTCCAAGTGG 0: 1
1: 0
2: 0
3: 11
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010601007 Original CRISPR AAGGCTGTACACTTTGAGAA GGG (reversed) Intronic
904398027 1:30236134-30236156 GAGGTGGTACTCTTTGAGAATGG - Intergenic
905543609 1:38780053-38780075 AGGGCTGTACACTTAGAAAGTGG - Intergenic
908429160 1:64038871-64038893 AAGGCCGTGAACTTTGAGGATGG - Intronic
908762665 1:67526353-67526375 AATACTGTACAATTGGAGAATGG + Intergenic
908797639 1:67846928-67846950 AAGGCAGTACTTTTTTAGAAGGG + Intergenic
908998583 1:70190046-70190068 AAGACTGTACAAATTGAGCAGGG + Intronic
910215338 1:84838356-84838378 CAGTCTGTAATCTTTGAGAATGG - Intronic
912141524 1:106735611-106735633 AAGGCTGTTCACTTAAAGATTGG - Intergenic
912319644 1:108700436-108700458 AATGCTAAAGACTTTGAGAATGG + Exonic
916394485 1:164370832-164370854 AAAGCTGTACACTTTGGGTATGG + Intergenic
917361694 1:174183523-174183545 AAGGCTGTGCACGTTGTGTAAGG - Intronic
919123750 1:193372157-193372179 AAGGCTGAAGACTTAGAAAAGGG + Intergenic
919222616 1:194649651-194649673 TATGCTGTACACTTTGATAAAGG + Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920031654 1:203041086-203041108 AAGGCTGTATCCTTTGAGATGGG + Intronic
920254354 1:204644371-204644393 AGGGGTCTACCCTTTGAGAAAGG - Intronic
920744468 1:208613508-208613530 GTGGCTGTAAACTTTGAGACAGG - Intergenic
921699515 1:218251796-218251818 AAAGTTGCAGACTTTGAGAAGGG + Intergenic
1067727625 10:48782725-48782747 AAGGCTCAGCATTTTGAGAAGGG - Intronic
1068777134 10:60879927-60879949 AAGTCTGTACATGTTCAGAACGG - Intronic
1069998668 10:72359681-72359703 AAGGCTGTGCTGTTTCAGAAGGG + Intergenic
1070001267 10:72379502-72379524 AAGGCTGTGCCCTGAGAGAATGG - Intronic
1071346901 10:84701777-84701799 AAGACTGAAGACTCTGAGAAAGG + Intergenic
1072216511 10:93291696-93291718 AAAGCTGTACTCTTTGAAATAGG + Intergenic
1078741814 11:14073744-14073766 TATGCTGTAAACTTTGAGAATGG + Intronic
1079651277 11:22933258-22933280 AAAGCCATACACTTTGTGAAAGG - Intergenic
1080241088 11:30128012-30128034 AAGGCTGTCCAGGTTGACAAAGG - Intergenic
1080666124 11:34337941-34337963 GAGGATGTACAGTTTGGGAAAGG - Intronic
1090713193 11:129406627-129406649 AAGGCTCTGCTCTCTGAGAAGGG + Intronic
1094553186 12:31471901-31471923 AAGTCTGTTTACCTTGAGAAGGG + Intronic
1095279440 12:40333266-40333288 AAGGCTGAACACCCTGAGAGGGG - Intronic
1096720028 12:53514328-53514350 AAGGGAGGACACTTTCAGAAAGG - Exonic
1098191714 12:67956173-67956195 AAGGCTGGAGACTTTGTGAATGG + Intergenic
1098626032 12:72670112-72670134 AAGCCTGTTCACTTGGGGAATGG - Exonic
1099011488 12:77296638-77296660 AAGCCTGTGCTATTTGAGAAGGG + Intergenic
1099068906 12:78020249-78020271 AAGGTAGTACAGTTTGATAAAGG + Intronic
1099246659 12:80200912-80200934 AAGGCTGAACACTTTGGCAATGG + Intergenic
1101422122 12:104558474-104558496 AATTCTGTACACTTTGGGAGGGG - Intronic
1103597813 12:122034872-122034894 AGTGGAGTACACTTTGAGAAAGG + Intronic
1104017418 12:124970322-124970344 ATGGCTGCACACTCTGTGAACGG + Intronic
1104191014 12:126481773-126481795 AAGGCTGCAAACTTTTCGAACGG - Intergenic
1104435472 12:128752915-128752937 AGGGGTGTTCACTTGGAGAAGGG - Intergenic
1105073852 12:133257706-133257728 AAACCTGTACTCTTTGAGAGAGG - Intergenic
1105828862 13:24146292-24146314 AAGGCTGTTCCCATTGTGAAAGG + Intronic
1107210754 13:37851810-37851832 AAGTCTGTGCACTTGGAGGAGGG + Intronic
1107246365 13:38301129-38301151 AAGGCTGGACATGTGGAGAATGG - Intergenic
1108714636 13:53066842-53066864 AAGGCTGGACACATTAAAAATGG + Intergenic
1109255381 13:60074038-60074060 AATGCTGAAAACTTTGATAAAGG + Intronic
1110561692 13:76916778-76916800 AAGGCTCTAGATTTTCAGAATGG - Intergenic
1111252589 13:85622457-85622479 AAGGCAGTAAACTTGGAAAAAGG + Intergenic
1111541025 13:89667393-89667415 TAGGCTGTAAACTTTTACAATGG - Intergenic
1113759027 13:112834826-112834848 AGTGCTGGACACTTAGAGAAGGG + Intronic
1116085861 14:40237000-40237022 GAGTCTGTGCACTTTGGGAAGGG - Intergenic
1120858142 14:89230813-89230835 AAGGCTGAACACTGTAAGGAGGG - Intronic
1121582871 14:95044242-95044264 AAGTCAGTGCACTTTGAAAACGG - Intergenic
1125498734 15:40223275-40223297 GTGGATGTACACTTTGTGAATGG - Intergenic
1127495422 15:59506763-59506785 AAGGCTGTATAGTATGAGTAGGG - Intronic
1132160331 15:99535535-99535557 CTGGCTGTACACTTTGGCAATGG + Intergenic
1132268769 15:100504195-100504217 AAGGCTGTGCCCCTGGAGAAAGG + Intronic
1134915345 16:18065022-18065044 AAGGCTGAACCCATTCAGAAAGG + Intergenic
1138748169 16:59388104-59388126 CAGGCTGTATACATTGAAAAGGG - Intergenic
1141505849 16:84477880-84477902 CAGGCAGTGCACTTAGAGAAAGG - Exonic
1144506043 17:15831937-15831959 AAGGCTGTAAGGTGTGAGAATGG + Intergenic
1145170217 17:20649859-20649881 AAGGCTGTAAGGTGTGAGAATGG + Intergenic
1149169140 17:53789719-53789741 AAGGTTATACAGTTTGTGAAAGG + Intergenic
1153909146 18:9691241-9691263 AAGGCTGTACAATCAGAGCACGG - Intergenic
1156891718 18:42198064-42198086 AAGGCTTTACTCCTTGAGCATGG - Intergenic
1158326773 18:56321266-56321288 AACTCTGAACACTTTCAGAAAGG + Intergenic
1164184608 19:22852359-22852381 AAGTCTGTACAATTTAAGAATGG + Intergenic
1164187159 19:22880494-22880516 AAGCCAGGGCACTTTGAGAAGGG + Intergenic
1166269082 19:41702552-41702574 AATTCTGTAGACTTTGGGAAGGG + Intronic
927906566 2:26862869-26862891 TAGGCTGTACACATTGAAAATGG - Intronic
929824545 2:45299964-45299986 AAGGCTCTGCACTCAGAGAAAGG + Intergenic
930587729 2:53289337-53289359 AAGGCTCAACTCTTTCAGAAGGG - Intergenic
931016248 2:57983386-57983408 AAGGCTGTGGACCTTGAGATGGG - Intronic
931132907 2:59359057-59359079 AAGGCTGAATTCCTTGAGAAAGG - Intergenic
931510520 2:62986872-62986894 AAGGATGTACTTTTTCAGAAAGG + Intronic
931796886 2:65719792-65719814 CAGGGGGTTCACTTTGAGAATGG + Intergenic
932030632 2:68180460-68180482 AAGACTGTACAATTTGAGCCGGG - Exonic
933675118 2:85048653-85048675 AAGGCTGTACTCATTAAGAGAGG - Intronic
934061178 2:88295730-88295752 GAGGATGTACAGTTTGAAAAGGG + Intergenic
935437957 2:103056917-103056939 TAGTCTGTACACTTTGGGGAGGG - Intergenic
935479749 2:103571666-103571688 AAGCTTGAACAATTTGAGAAAGG + Intergenic
936621799 2:114107866-114107888 AAGGCTGTTCACAATGAGCAAGG + Intergenic
937193087 2:120123590-120123612 ACCACTGTACATTTTGAGAATGG - Intronic
938137925 2:128774542-128774564 AAGGCTGTGCACTTTGCAATAGG - Intergenic
939154661 2:138509963-138509985 AAGGCTACACACTTTGGAAATGG - Intronic
939284093 2:140106552-140106574 AATGCTGTGAACTCTGAGAAAGG + Intergenic
940486000 2:154296055-154296077 AAGGAGGCACACTTTGAGAAAGG - Intronic
942182003 2:173388999-173389021 ATGGTTGTACAGTTTGTGAATGG - Intergenic
942535342 2:176957105-176957127 AACTCAGAACACTTTGAGAAAGG + Intergenic
942892258 2:181005445-181005467 AAGCATGTAGACTGTGAGAAGGG + Intronic
945732275 2:213553582-213553604 ATGGGTATACATTTTGAGAAAGG - Intronic
946297054 2:218793397-218793419 AAACCTGTACTCTTTGATAAAGG + Intronic
946445166 2:219733287-219733309 CAGGCAGTACAAGTTGAGAAAGG + Intergenic
947975903 2:234365707-234365729 AATTCTGTACATTTTCAGAATGG + Intergenic
948561738 2:238858443-238858465 AAGGCTGTTGACTTTGCGAGAGG + Intronic
1169635370 20:7685258-7685280 AAGGCTGTTTATTTAGAGAAAGG + Intergenic
1170667910 20:18402654-18402676 AAGGAAGTACACTTTGAAGAAGG - Intronic
1172100554 20:32482499-32482521 AAGGCTGGACACTTTGGATAGGG - Intronic
1172573607 20:35989493-35989515 AAGGCTGGAGGCTTTAAGAAGGG + Intronic
1173631929 20:44522690-44522712 AAGGCTTTACTCTGTTAGAAAGG - Intergenic
1173969273 20:47138851-47138873 AAGGCTGTACACAAAAAGAAAGG - Intronic
1175996136 20:62813089-62813111 AAGGCTGGACACAGTGAGAACGG + Exonic
1179076278 21:38124892-38124914 TAGGCTGTACACTTAAAAAATGG - Intronic
1181657210 22:24312754-24312776 GAGGCTTTACAGTTTGAGAAAGG - Intronic
1182267490 22:29129433-29129455 AAGGCTGAGCACTTTGGAAATGG + Intronic
1182986524 22:34723229-34723251 AAAGCTGTACCCTCTGAGACAGG - Intergenic
1183027047 22:35073069-35073091 AGGACTGTTTACTTTGAGAAAGG - Intronic
950211997 3:11130471-11130493 AAGCCTGGACGCTTTGAGAGTGG - Intergenic
950515417 3:13461788-13461810 AAGGCTGTAGACTTTGAGGGTGG + Intergenic
950615504 3:14154754-14154776 TAGGCTGTACACTTAAAAAATGG + Intronic
953025424 3:39142259-39142281 AAGGCTGTGGCCTTTGGGAAGGG + Exonic
953621063 3:44533330-44533352 AAGACTTTACAATTTGAGAAGGG - Intergenic
954066071 3:48107212-48107234 AAAACTGTACCCCTTGAGAAGGG - Intergenic
954213687 3:49112359-49112381 CAGGCTGCACACTTGGAGATGGG + Exonic
954762440 3:52886081-52886103 AAGGCTTTTCATTTTGAGATTGG - Intronic
955213475 3:56963519-56963541 AAGGTGGTAGTCTTTGAGAAGGG - Intronic
957230629 3:77509740-77509762 AAGGCTGTACACGTGCAGGAAGG - Intronic
959806712 3:110562874-110562896 AAAGCTGTACACTTGGGGGAAGG - Intergenic
959857209 3:111173762-111173784 TAGGCTGTACACTTTACTAAAGG - Intronic
963975512 3:151475841-151475863 AAAGCTGAACACCTTGAGCAAGG - Intergenic
963978352 3:151508524-151508546 AAACCTGTACTCTTTGATAAAGG - Intergenic
964568085 3:158080483-158080505 CATGCTGTACACTTTTAGATTGG + Intergenic
967041172 3:185694303-185694325 AAGGCTGTAGACTCCCAGAAAGG + Intronic
970865843 4:20757709-20757731 AAGACTATACACTTTGGAAATGG + Intronic
973707984 4:53598766-53598788 AAGCCTGAACACTTTGGGAAGGG + Intronic
974755996 4:66208995-66209017 AAGGCTGTACCCTCTGAGGGGGG - Intergenic
976318515 4:83685358-83685380 AAGGGTGGAGACTTTGTGAATGG - Intergenic
976724525 4:88202658-88202680 CAGCCTGTACACTGGGAGAACGG - Intronic
977789894 4:101087383-101087405 AAGGGTGTTCACTTTGTGAAAGG - Intronic
977962591 4:103102950-103102972 AAGGCTCTACTCTTTGAGATGGG + Intergenic
978250344 4:106623449-106623471 ATGACTGTATACTTTTAGAAAGG - Intergenic
979119048 4:116870275-116870297 AAGTCTGTATGCTTTTAGAAGGG + Intergenic
980208982 4:129760554-129760576 CAGGCTGAAAATTTTGAGAATGG - Intergenic
983659186 4:170115643-170115665 AAACCTTTACTCTTTGAGAATGG - Intergenic
983825744 4:172257383-172257405 AAGCCTGTACATTTTGAAGAAGG + Intronic
983904916 4:173172109-173172131 AAGGAAGTACACTTTGAAGAAGG + Intronic
985869644 5:2544160-2544182 AAGTTTGCACACTTTGAGAACGG + Intergenic
987485759 5:18523616-18523638 AGGCATCTACACTTTGAGAAGGG - Intergenic
989737045 5:44720233-44720255 AAGGCTAGACACTTTGAGTAAGG - Intergenic
990288417 5:54324604-54324626 ATGGATGTAAACCTTGAGAAAGG + Intergenic
990389630 5:55305937-55305959 AAGGATTGACACCTTGAGAAAGG + Intronic
993502128 5:88676177-88676199 AACGCTGTAGCCTTCGAGAACGG + Intergenic
993683966 5:90915527-90915549 AAGGCTAAACTCTTTTAGAAAGG + Intronic
995134405 5:108665295-108665317 AATGCTGTACACATTGAACATGG - Intergenic
997189931 5:131922358-131922380 AAGGCTGTATATGTTGAGTATGG - Intronic
997273987 5:132567329-132567351 AGGGCTATATTCTTTGAGAAAGG + Intronic
998623979 5:143824725-143824747 AAGTACGTACACTTTCAGAATGG - Intergenic
999914006 5:156237644-156237666 AAAGCGGGACACTTTCAGAAGGG + Intronic
1003631820 6:7794347-7794369 AAGAATGTACACTTTGGGAGAGG + Intronic
1003806970 6:9736593-9736615 AAGGCTTTACTCCATGAGAATGG - Intronic
1003806974 6:9736626-9736648 AAGGCTTTACTCCATGAGAATGG - Intronic
1003998606 6:11569974-11569996 ACAGCTGTTAACTTTGAGAAAGG - Intronic
1004779977 6:18897539-18897561 AGGGCTGCAGACTTTCAGAATGG + Intergenic
1005181839 6:23115167-23115189 AAGTGTCTACCCTTTGAGAATGG + Intergenic
1005464083 6:26094792-26094814 AAGGCTGTACACTGCACGAATGG + Exonic
1009744733 6:67798279-67798301 AAATCTGTGCACTTTGAGGAGGG + Intergenic
1010536824 6:77040771-77040793 CAGGCTGTATTCATTGAGAAAGG - Intergenic
1010601007 6:77826504-77826526 AAGGCTGTACACTTTGAGAAGGG - Intronic
1012978857 6:105809078-105809100 AACTCTGTTTACTTTGAGAAAGG + Intergenic
1015584441 6:134761009-134761031 AAGCCTGTACAGCTTGTGAATGG + Intergenic
1020736923 7:11962136-11962158 AAAGCTTTACTATTTGAGAAAGG + Intergenic
1020894540 7:13923623-13923645 AAGCCTGTAAATTTAGAGAACGG - Intronic
1023432276 7:40107094-40107116 AAGGCTGTACATATTCAGTATGG + Intergenic
1026230487 7:68479097-68479119 AAGGCTGAACATTTTGAGTTTGG + Intergenic
1027138864 7:75642786-75642808 AAGGCTGTCCATTGTGGGAAGGG - Intronic
1027267738 7:76503550-76503572 AATGCTGTAAACTATGAGGATGG - Exonic
1027319549 7:77003412-77003434 AATGCTGTAAACTATGAGGATGG - Intergenic
1028351723 7:89857760-89857782 AAGCATGTACCCTTAGAGAATGG - Intergenic
1033508081 7:142025966-142025988 AAGACTGTACAGTTTTAGATAGG + Intronic
1035494604 7:159312751-159312773 AAACCTGTACTCTTTGAGAGAGG - Intergenic
1035712475 8:1729283-1729305 AAGGCTGGAGACCTTGAGACGGG - Intergenic
1036253892 8:7188614-7188636 AATGCTGCCCACTTAGAGAAAGG - Intergenic
1036363601 8:8098865-8098887 AATGCTGCCCACTTAGAGAAAGG + Intergenic
1036887353 8:12568204-12568226 AATGCTGTCCACTTAGAGAAAGG - Intergenic
1036894946 8:12626305-12626327 AATGCTGTCCACTTAGAGAAAGG - Intergenic
1039629680 8:39097108-39097130 AAGGCTGCAAAATCTGAGAAAGG - Intronic
1040417154 8:47205788-47205810 AAGGCTGTAGACTGAGGGAAGGG + Intergenic
1041540282 8:58976948-58976970 AAGGCTCTAGATTTTCAGAATGG + Intronic
1041883954 8:62786737-62786759 AAGCTTTTACCCTTTGAGAAAGG + Intronic
1042051717 8:64717002-64717024 AAGTGTGTACACTTTCAGCATGG + Intronic
1042159306 8:65876085-65876107 AAACCTGTACTCTTTGATAAAGG - Intergenic
1042218836 8:66453460-66453482 AAGGCTGTGCACAATCAGAAAGG + Intronic
1042463081 8:69093670-69093692 AATGCTTTCCACTTTGATAATGG + Intergenic
1042626444 8:70763106-70763128 CAGGCTGTAGTCTGTGAGAAAGG + Intronic
1042898267 8:73694779-73694801 AAATCTGTACACTTTGAGGGAGG + Intronic
1045841134 8:106582911-106582933 AAGGCTGAACACTGTGGGGAGGG - Intronic
1046680116 8:117159411-117159433 GAGCATGTACACTTTGAAAAAGG + Intronic
1048265424 8:132981265-132981287 AATGCTGAACACTATGAGAATGG - Intronic
1048432980 8:134387662-134387684 AAAGCTGTACAGATTGTGAAAGG + Intergenic
1052673243 9:31585269-31585291 AAGGCTGTCCTCTTTGAGATGGG - Intergenic
1054787825 9:69225932-69225954 AAGCCTTTACATTTTTAGAAGGG + Intronic
1056913772 9:90727836-90727858 AAGGCTGCTAACTTTGGGAAGGG - Intergenic
1057023189 9:91716694-91716716 AAGGCTGCACACTCTGCAAATGG + Intronic
1186845276 X:13524602-13524624 AAGGCTTTACACTATGAGCTTGG + Intergenic
1189061439 X:37757529-37757551 AAGGGTGTACATTTAGGGAAGGG - Intronic
1190899888 X:54661060-54661082 AAGGCTGTACACATGAAGAAAGG + Intergenic
1193870372 X:86789891-86789913 AATGATGTACATTTTGACAAAGG + Intronic
1195705626 X:107736115-107736137 AAAGAGGTACACTTGGAGAAGGG - Intronic
1197017179 X:121639186-121639208 AAGGCTGTAGAATTTTACAAAGG + Intergenic
1197633441 X:128888298-128888320 AAGGCAGTACAGTTTGATACAGG - Intergenic
1198154596 X:133946482-133946504 AATACAGTACACTTTCAGAAAGG + Intronic
1198623471 X:138540815-138540837 CAGGTTGTATACTTTGAAAAAGG + Intergenic
1201979506 Y:19891814-19891836 GAATCTGTACACTTTGGGAAAGG + Intergenic