ID: 1010602127

View in Genome Browser
Species Human (GRCh38)
Location 6:77842122-77842144
Sequence CCAAATTCATAGTCTTTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010602123_1010602127 29 Left 1010602123 6:77842070-77842092 CCATTGACTAGTTTGACTTGTGT 0: 1
1: 0
2: 2
3: 11
4: 203
Right 1010602127 6:77842122-77842144 CCAAATTCATAGTCTTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010602127 Original CRISPR CCAAATTCATAGTCTTTTCA AGG Intronic
No off target data available for this crispr