ID: 1010603152

View in Genome Browser
Species Human (GRCh38)
Location 6:77855494-77855516
Sequence TCTTCCAAGCATACTCATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010603152_1010603153 23 Left 1010603152 6:77855494-77855516 CCTTAATGAGTATGCTTGGAAGA 0: 1
1: 0
2: 0
3: 16
4: 127
Right 1010603153 6:77855540-77855562 AGATTTCCATGCTTTGCTAATGG No data
1010603152_1010603156 29 Left 1010603152 6:77855494-77855516 CCTTAATGAGTATGCTTGGAAGA 0: 1
1: 0
2: 0
3: 16
4: 127
Right 1010603156 6:77855546-77855568 CCATGCTTTGCTAATGGGATTGG No data
1010603152_1010603154 24 Left 1010603152 6:77855494-77855516 CCTTAATGAGTATGCTTGGAAGA 0: 1
1: 0
2: 0
3: 16
4: 127
Right 1010603154 6:77855541-77855563 GATTTCCATGCTTTGCTAATGGG 0: 1
1: 0
2: 2
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010603152 Original CRISPR TCTTCCAAGCATACTCATTA AGG (reversed) Intronic
902626413 1:17679201-17679223 TCTTCCCAGCAAACTGGTTAAGG - Intronic
905178296 1:36151649-36151671 TGTTCCAAGGATTCTCAGTATGG + Intronic
908548343 1:65184685-65184707 TCTTCCAAGCAAACTGACAAGGG + Intronic
909683624 1:78320881-78320903 TCTTCCAGGCCTCCTCAATATGG + Intronic
910426256 1:87122461-87122483 TCTGCCAGGCATACTCCTTCTGG - Intronic
912543638 1:110435364-110435386 TCTCCCAAGCATAGACTTTATGG + Intergenic
918933450 1:190887972-190887994 TCTTCAACAAATACTCATTAAGG - Intergenic
921498086 1:215865514-215865536 TCTTAAAAGCCTACTCATAAAGG - Intronic
924822176 1:247503837-247503859 GCTTCCAAGCACACTCATGTGGG + Intergenic
1064743053 10:18452828-18452850 TCTACCAGGTATACTCATTAAGG - Intronic
1068160574 10:53257593-53257615 ACTTATAAGCATACTGATTATGG + Intergenic
1074723389 10:116283535-116283557 TCTACCGAGGACACTCATTAGGG - Intergenic
1076092349 10:127698710-127698732 TCTTCCAAAAATACTGATTCAGG + Intergenic
1077958410 11:7046889-7046911 TCTTCCACTCATACTCGTTAGGG + Intronic
1079611485 11:22437631-22437653 GCTTCCATCCATACCCATTAGGG - Intergenic
1079621418 11:22560136-22560158 TCTTCCATGCATACGTATCATGG - Intergenic
1080230340 11:30012777-30012799 TCTTCCAAGCAATCTGCTTAAGG - Exonic
1080788216 11:35495236-35495258 TCTCCCAAACATACTAATTAAGG - Intronic
1081074606 11:38655079-38655101 TCTTCCATGAATATTCCTTACGG + Intergenic
1083447656 11:62720092-62720114 TCTTCCAATCTTCCTCATTAGGG + Exonic
1084347375 11:68563404-68563426 TCTTCGAAGCATAGTTATGATGG + Intronic
1092169090 12:6362194-6362216 TCTACCAGACATACTCATCAGGG - Exonic
1094812385 12:34151246-34151268 ACTTCCAAGCACACTCATTGTGG - Intergenic
1100657642 12:96664009-96664031 TTTTACAAACATACTAATTATGG - Intronic
1108965492 13:56294050-56294072 ACTTCCAAGCACAGTGATTATGG + Intergenic
1110873136 13:80476003-80476025 TTTTCCAAGCATTCTAATTAAGG - Intergenic
1110995243 13:82099738-82099760 TTTATCAAGCATACTCATTTGGG - Intergenic
1111363102 13:87202694-87202716 ACTTCCAAGCATATTCTTTGAGG - Intergenic
1112356904 13:98681200-98681222 ACTTCCAAGCATAATCAAGATGG - Intergenic
1112954163 13:105039176-105039198 TGTTCCAAGCAAACTAATTATGG - Intergenic
1120035382 14:79691101-79691123 TATTTGAAGCATATTCATTAAGG + Intronic
1120119011 14:80655519-80655541 TCTGCCTAGCATCCTCTTTAGGG + Intronic
1120849679 14:89158564-89158586 TCTTGAAAGAATACTGATTAGGG + Exonic
1130207123 15:81887560-81887582 TCTTTCCAGCAATCTCATTATGG - Intergenic
1136046057 16:27615917-27615939 TCTTCCCAGGATAAGCATTAAGG + Intronic
1136120674 16:28131437-28131459 TCTTCCCAGCATGCTTCTTATGG - Intronic
1140414078 16:74760837-74760859 TTTTCAATGCATACTCATTAGGG - Intronic
1140518815 16:75565141-75565163 TTTTCCAAGCAGACTCATCAAGG - Intergenic
1141392559 16:83677020-83677042 TCTTGCAAGAATACCCATTACGG + Intronic
1143833947 17:9675018-9675040 ACTTCCATCCTTACTCATTACGG + Intronic
1150443545 17:65210834-65210856 TCTCCCAAGCCCACTCATCAGGG + Intronic
1150494255 17:65594987-65595009 AATCCCAAGCATACACATTAGGG - Intronic
1150555700 17:66252341-66252363 TCATCCAAGCATACATATTAGGG + Intronic
1203166239 17_GL000205v2_random:99034-99056 TCTTCAAAGCATACACAACATGG - Intergenic
1153342235 18:3987276-3987298 TCTTCCAGGCCTACTCACTGAGG + Intronic
1156805821 18:41179220-41179242 TCCTCCAAGCATACTAACTATGG + Intergenic
1158058017 18:53304687-53304709 ACTTCCAAGCATAGTCCTGAAGG - Intronic
1158218395 18:55124466-55124488 TCTTCCAAGTGTACTTATAATGG - Intergenic
1160032250 18:75272171-75272193 ACATCCGAGCATTCTCATTAGGG - Intronic
1166089172 19:40497199-40497221 TCTTCCAAGCACACTCAGGCTGG + Intronic
1166867449 19:45848648-45848670 GCATCCGAGCATACTCTTTATGG - Intronic
930215125 2:48688327-48688349 TCCTCCAAGCATAATCAGAATGG + Exonic
932359708 2:71093887-71093909 TCTTCCAAACATAATAATTTTGG - Intergenic
936067941 2:109346153-109346175 GCTTCCAATAATACTCATTCTGG - Intronic
936922756 2:117706296-117706318 TCTTCAAAGCATCCTTATCAAGG - Intergenic
939442959 2:142273380-142273402 TCTTCAAAGCATACTTTTTCTGG - Intergenic
940864333 2:158802501-158802523 TCTTGAAAGCATTATCATTATGG - Intronic
942739113 2:179153713-179153735 TGTTCCAAGCTCACTCATCATGG - Intronic
943251014 2:185521777-185521799 CCATCAAAGCAAACTCATTATGG - Intergenic
944045745 2:195409847-195409869 TATTCTAAGCATACTCTTTGAGG + Intergenic
945106747 2:206323494-206323516 TCAACCAATCATACTCAGTAGGG - Intergenic
945183740 2:207118534-207118556 ACTTCCAAGCTTACTAATAAAGG - Intronic
1170452343 20:16496880-16496902 TTTTTCAAGAATACACATTATGG - Intronic
1170891938 20:20383337-20383359 TCTTCCAAGATTAGTCATAAAGG - Intergenic
1170917292 20:20639520-20639542 TCTTGCAAGCATAGAGATTAGGG + Intronic
1176335280 21:5591520-5591542 TCTTCAAAGCATACACAACATGG + Intergenic
1176392477 21:6229428-6229450 TCTTCAAAGCATACACAACATGG - Intergenic
1176405516 21:6360062-6360084 TCTTCAAAGCATACACAACATGG + Intergenic
1176468942 21:7086746-7086768 TCTTCAAAGCATACACAACATGG + Exonic
1176492503 21:7468524-7468546 TCTTCAAAGCATACACAACATGG + Intergenic
1176508139 21:7669859-7669881 TCTTCAAAGCATACACAACATGG - Intergenic
1178720999 21:35008771-35008793 GCTTCTAACCATACTGATTATGG + Intronic
1184048472 22:41987314-41987336 TCTTCCCAGCAGAGTCTTTAGGG - Intronic
1184700496 22:46168947-46168969 GCTTCCAAGGCTACACATTATGG + Intronic
950915938 3:16645282-16645304 TGTTCCAAGCATGCTTTTTATGG - Intronic
953779145 3:45850898-45850920 TCATTCAAGCATACTCAATCAGG + Intronic
955497801 3:59554165-59554187 TCGCCCAACCATACTCAATAAGG - Intergenic
955616945 3:60819592-60819614 CCTTCTAATCATAATCATTATGG + Intronic
957984424 3:87555011-87555033 TCTGCTAAGCAGACGCATTATGG + Intergenic
960187190 3:114658204-114658226 TCTCCCAAGCAAGTTCATTAAGG - Intronic
961972395 3:130983734-130983756 TATTCCAACCATACACATTCTGG - Intronic
962190088 3:133301109-133301131 TCTTCCAATAATACTCTTTAAGG - Intronic
963069852 3:141294287-141294309 TCTTCCAATAAAACTAATTATGG + Exonic
965049961 3:163633924-163633946 AGTGCCAAGAATACTCATTAAGG - Intergenic
965829016 3:172761442-172761464 TCTTCCAATCATACAAGTTAGGG - Intronic
971104277 4:23505536-23505558 TTTTCCAAGCATAATTCTTAAGG - Intergenic
971939417 4:33195875-33195897 TCTTCCAAACATTCTTATTCTGG + Intergenic
973761258 4:54117710-54117732 GCTTCCAGCCATACTCAATAGGG - Intronic
974354285 4:60792097-60792119 TCTCACAAGCAAAGTCATTAGGG + Intergenic
975597511 4:76063927-76063949 TCTTCCATGCATCCTTTTTAAGG + Intronic
977243838 4:94605706-94605728 TCTTCCAAGCAAACGCACTTGGG - Intronic
982167830 4:152631203-152631225 TCTTCCAACACTACTCTTTAGGG + Intronic
983274962 4:165605689-165605711 ACTTCCAAGCTCACTCATTAGGG + Intergenic
984405400 4:179323158-179323180 TCTTCCAAGTATCATCATTTTGG - Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
986550020 5:8942851-8942873 TTTTCCAAGCATAAACATTCAGG - Intergenic
989220550 5:38956861-38956883 ACTTCCAAGCATACAACTTAAGG - Intronic
989236170 5:39150861-39150883 TCTTCTCAGCATAGCCATTAAGG + Intronic
989250505 5:39309059-39309081 TCTTGGAAGCTGACTCATTATGG + Intronic
990834416 5:60000456-60000478 TCAACCAAGCATACTCTTTCTGG + Intronic
992185428 5:74239753-74239775 TCTTCCAAGGAATCTCAGTAAGG + Intergenic
995605130 5:113845901-113845923 TCTTCCAAGTATCTTCATAAAGG - Intergenic
998667692 5:144317191-144317213 TCTTCAAAACATAAACATTAAGG + Intronic
999001148 5:147924293-147924315 TCTTAAAAGCATGCTCTTTAAGG - Intergenic
1002463853 5:179393923-179393945 TCTTCCAAGCAAGCTCCTTTTGG + Intergenic
1010065200 6:71674291-71674313 ACTTCCAAGCATTCTCTTCAGGG + Intergenic
1010603152 6:77855494-77855516 TCTTCCAAGCATACTCATTAAGG - Intronic
1012980900 6:105829760-105829782 TCTTCCAAGAAAACTATTTAAGG - Intergenic
1014029852 6:116687990-116688012 TCTGCCATGCATCCTCATTTTGG + Intronic
1014623238 6:123695432-123695454 GCTTCCAAACACAATCATTAGGG + Intergenic
1014853817 6:126374530-126374552 TCTACCAAGCTTAATCATCAAGG - Intergenic
1016668554 6:146673183-146673205 TCTTGAAAGCATACTTTTTAGGG + Intronic
1017883664 6:158580502-158580524 TCTTCCAAAAATACTTATTAAGG - Intronic
1023113734 7:36840069-36840091 TCTACAAGGCATACTCCTTAGGG - Intergenic
1028020329 7:85763729-85763751 TATCACAAACATACTCATTATGG + Intergenic
1030634973 7:111938497-111938519 TCTTCAGAGCAGACTTATTAGGG - Intronic
1031033712 7:116764586-116764608 CCTTCCAAGCACAGTCTTTATGG + Intronic
1031132607 7:117849997-117850019 ACTTCCAGGGATACTCATGAAGG + Intronic
1031251062 7:119380901-119380923 TCTTCCAAGTTTACTGATTTTGG - Intergenic
1031718587 7:125139628-125139650 TCTTCCAAGCATTCTGTTAATGG + Intergenic
1032565240 7:132934967-132934989 TATTCCAGGCATGTTCATTATGG - Intronic
1035761818 8:2074075-2074097 TCTTCACAGCAGACTCACTAGGG + Intronic
1038426394 8:27466950-27466972 TTTTCAAAGAATACTCAGTATGG + Intronic
1040775894 8:51042994-51043016 TCTACCCAGCATAGTGATTATGG - Intergenic
1041853085 8:62416209-62416231 TCTACAATTCATACTCATTAAGG + Intronic
1044364494 8:91326955-91326977 TCTTACAAGGATACTGATCATGG + Intronic
1051866501 9:21689072-21689094 TCTTTAAAGCAGACTTATTATGG - Intergenic
1055317148 9:75045467-75045489 CCTTCCCAGCGTACACATTAGGG + Intergenic
1055541794 9:77315607-77315629 TCCTCCAAGAAAACACATTAAGG - Intronic
1059722130 9:116970120-116970142 TCTTATAAGGGTACTCATTATGG + Intronic
1061114283 9:128598893-128598915 TCTCTCAAGAATACTTATTATGG - Intronic
1203426359 Un_GL000195v1:43400-43422 TCTTCAAAGCATACACAACATGG - Intergenic
1203439898 Un_GL000195v1:179667-179689 TCTTCAAAGCATACACAACATGG + Intergenic
1188060932 X:25600941-25600963 TCTTCCAAGCTTACTCATGTAGG - Intergenic
1188245445 X:27831516-27831538 TCTGCCAAATATTCTCATTAGGG + Intergenic
1190714233 X:53090619-53090641 TCTTCACCGCATACTCATTGGGG - Intergenic
1193526334 X:82594545-82594567 TCTTCCAACCACAAACATTAGGG - Intergenic
1194322588 X:92469668-92469690 TGTTCCAAGAATATACATTAGGG - Intronic
1194422288 X:93690962-93690984 TCTTCAAAGAAAACACATTAGGG - Intronic
1196739528 X:119012354-119012376 TCTTCCAAGCAAACCCAATGAGG - Intronic
1198416763 X:136428174-136428196 TGTACCATGCATACTCATTCAGG + Intergenic
1199364341 X:146961750-146961772 TCATCCAAGCATAGAAATTATGG + Intergenic
1199734689 X:150674499-150674521 TCTTCCAAGTATGTTCAATATGG - Intergenic
1200283992 X:154803516-154803538 TCTTTCAAGCATGCCCATAAGGG + Intronic