ID: 1010615502

View in Genome Browser
Species Human (GRCh38)
Location 6:78007080-78007102
Sequence CGGGGAGAATGGAAGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010615494_1010615502 12 Left 1010615494 6:78007045-78007067 CCAAACCTACATTTGATTGATGT 0: 11
1: 217
2: 767
3: 2044
4: 4394
Right 1010615502 6:78007080-78007102 CGGGGAGAATGGAAGGAAGTTGG No data
1010615495_1010615502 7 Left 1010615495 6:78007050-78007072 CCTACATTTGATTGATGTACCTG 0: 7
1: 199
2: 393
3: 435
4: 529
Right 1010615502 6:78007080-78007102 CGGGGAGAATGGAAGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010615502 Original CRISPR CGGGGAGAATGGAAGGAAGT TGG Intergenic
No off target data available for this crispr