ID: 1010616605

View in Genome Browser
Species Human (GRCh38)
Location 6:78020566-78020588
Sequence GGGCAGGTTAATATGAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010616605_1010616610 14 Left 1010616605 6:78020566-78020588 CCTCAATTCATATTAACCTGCCC No data
Right 1010616610 6:78020603-78020625 AATTGAAAGTGAGAATAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010616605 Original CRISPR GGGCAGGTTAATATGAATTG AGG (reversed) Intergenic
No off target data available for this crispr