ID: 1010622003

View in Genome Browser
Species Human (GRCh38)
Location 6:78088349-78088371
Sequence TAAACCATTTCTCCTTAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010622003_1010622006 24 Left 1010622003 6:78088349-78088371 CCATATTAAGGAGAAATGGTTTA No data
Right 1010622006 6:78088396-78088418 TGCAGATCACAATTGCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010622003 Original CRISPR TAAACCATTTCTCCTTAATA TGG (reversed) Intergenic
No off target data available for this crispr