ID: 1010622159

View in Genome Browser
Species Human (GRCh38)
Location 6:78090026-78090048
Sequence ATTCAGTGGAAGGCTGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010622154_1010622159 27 Left 1010622154 6:78089976-78089998 CCTATCATTTATGTAAAAATGCA No data
Right 1010622159 6:78090026-78090048 ATTCAGTGGAAGGCTGGTCAAGG No data
1010622155_1010622159 -7 Left 1010622155 6:78090010-78090032 CCAGAATAAATTGCGTATTCAGT No data
Right 1010622159 6:78090026-78090048 ATTCAGTGGAAGGCTGGTCAAGG No data
1010622153_1010622159 28 Left 1010622153 6:78089975-78089997 CCCTATCATTTATGTAAAAATGC No data
Right 1010622159 6:78090026-78090048 ATTCAGTGGAAGGCTGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010622159 Original CRISPR ATTCAGTGGAAGGCTGGTCA AGG Intergenic
No off target data available for this crispr