ID: 1010622503

View in Genome Browser
Species Human (GRCh38)
Location 6:78093528-78093550
Sequence GTTAGCAATGCTTATACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010622503_1010622507 2 Left 1010622503 6:78093528-78093550 CCTGAGGTATAAGCATTGCTAAC No data
Right 1010622507 6:78093553-78093575 ATTAACAATAGCATCGGGAAGGG No data
1010622503_1010622504 -4 Left 1010622503 6:78093528-78093550 CCTGAGGTATAAGCATTGCTAAC No data
Right 1010622504 6:78093547-78093569 TAACTTATTAACAATAGCATCGG No data
1010622503_1010622508 14 Left 1010622503 6:78093528-78093550 CCTGAGGTATAAGCATTGCTAAC No data
Right 1010622508 6:78093565-78093587 ATCGGGAAGGGCAAAGTATAAGG No data
1010622503_1010622505 -3 Left 1010622503 6:78093528-78093550 CCTGAGGTATAAGCATTGCTAAC No data
Right 1010622505 6:78093548-78093570 AACTTATTAACAATAGCATCGGG No data
1010622503_1010622506 1 Left 1010622503 6:78093528-78093550 CCTGAGGTATAAGCATTGCTAAC No data
Right 1010622506 6:78093552-78093574 TATTAACAATAGCATCGGGAAGG No data
1010622503_1010622509 27 Left 1010622503 6:78093528-78093550 CCTGAGGTATAAGCATTGCTAAC No data
Right 1010622509 6:78093578-78093600 AAGTATAAGGTCTCAGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010622503 Original CRISPR GTTAGCAATGCTTATACCTC AGG (reversed) Intergenic
No off target data available for this crispr