ID: 1010624199

View in Genome Browser
Species Human (GRCh38)
Location 6:78116207-78116229
Sequence CTCACACATAAGTGGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010624199_1010624202 16 Left 1010624199 6:78116207-78116229 CCTTGCTTCCACTTATGTGTGAG No data
Right 1010624202 6:78116246-78116268 TCTCTTGCTGTGTGATATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010624199 Original CRISPR CTCACACATAAGTGGAAGCA AGG (reversed) Intergenic
No off target data available for this crispr