ID: 1010626207

View in Genome Browser
Species Human (GRCh38)
Location 6:78138761-78138783
Sequence TATAACTTATACACAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010626207_1010626212 21 Left 1010626207 6:78138761-78138783 CCTCCCACTGTGTATAAGTTATA No data
Right 1010626212 6:78138805-78138827 TACCAGCCCAAACAAAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010626207 Original CRISPR TATAACTTATACACAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr