ID: 1010628467

View in Genome Browser
Species Human (GRCh38)
Location 6:78168273-78168295
Sequence ATGGGGAACCAGAAGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010628461_1010628467 -10 Left 1010628461 6:78168260-78168282 CCCAGCAAGATGGATGGGGAACC No data
Right 1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010628467 Original CRISPR ATGGGGAACCAGAAGGGGGA TGG Intergenic
No off target data available for this crispr