ID: 1010629495

View in Genome Browser
Species Human (GRCh38)
Location 6:78180507-78180529
Sequence TTCTCTACTCCACCCTTCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010629495_1010629496 9 Left 1010629495 6:78180507-78180529 CCTTCGAAGGGTGGAGTAGAGAA No data
Right 1010629496 6:78180539-78180561 GCTGCCTACCAGTCACATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010629495 Original CRISPR TTCTCTACTCCACCCTTCGA AGG (reversed) Intergenic
No off target data available for this crispr