ID: 1010629496

View in Genome Browser
Species Human (GRCh38)
Location 6:78180539-78180561
Sequence GCTGCCTACCAGTCACATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010629495_1010629496 9 Left 1010629495 6:78180507-78180529 CCTTCGAAGGGTGGAGTAGAGAA No data
Right 1010629496 6:78180539-78180561 GCTGCCTACCAGTCACATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010629496 Original CRISPR GCTGCCTACCAGTCACATAC TGG Intergenic
No off target data available for this crispr