ID: 1010637492

View in Genome Browser
Species Human (GRCh38)
Location 6:78279420-78279442
Sequence AACCTAACTTTGACCTCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010637486_1010637492 23 Left 1010637486 6:78279374-78279396 CCCAACCAGTTCTGCCAATGCAC No data
Right 1010637492 6:78279420-78279442 AACCTAACTTTGACCTCCTATGG No data
1010637487_1010637492 22 Left 1010637487 6:78279375-78279397 CCAACCAGTTCTGCCAATGCACC No data
Right 1010637492 6:78279420-78279442 AACCTAACTTTGACCTCCTATGG No data
1010637490_1010637492 1 Left 1010637490 6:78279396-78279418 CCCAAGTACAGAAGACATTAAGA No data
Right 1010637492 6:78279420-78279442 AACCTAACTTTGACCTCCTATGG No data
1010637488_1010637492 18 Left 1010637488 6:78279379-78279401 CCAGTTCTGCCAATGCACCCAAG No data
Right 1010637492 6:78279420-78279442 AACCTAACTTTGACCTCCTATGG No data
1010637491_1010637492 0 Left 1010637491 6:78279397-78279419 CCAAGTACAGAAGACATTAAGAA No data
Right 1010637492 6:78279420-78279442 AACCTAACTTTGACCTCCTATGG No data
1010637489_1010637492 9 Left 1010637489 6:78279388-78279410 CCAATGCACCCAAGTACAGAAGA No data
Right 1010637492 6:78279420-78279442 AACCTAACTTTGACCTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010637492 Original CRISPR AACCTAACTTTGACCTCCTA TGG Intergenic
No off target data available for this crispr