ID: 1010641012

View in Genome Browser
Species Human (GRCh38)
Location 6:78327297-78327319
Sequence ATGTATTTAAGGAGGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010641012_1010641019 -2 Left 1010641012 6:78327297-78327319 CCTGTTTCCCTCCTTAAATACAT No data
Right 1010641019 6:78327318-78327340 ATTGCCACCAGGAACACCTGGGG No data
1010641012_1010641018 -3 Left 1010641012 6:78327297-78327319 CCTGTTTCCCTCCTTAAATACAT No data
Right 1010641018 6:78327317-78327339 CATTGCCACCAGGAACACCTGGG No data
1010641012_1010641017 -4 Left 1010641012 6:78327297-78327319 CCTGTTTCCCTCCTTAAATACAT No data
Right 1010641017 6:78327316-78327338 ACATTGCCACCAGGAACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010641012 Original CRISPR ATGTATTTAAGGAGGGAAAC AGG (reversed) Intergenic
No off target data available for this crispr