ID: 1010644800

View in Genome Browser
Species Human (GRCh38)
Location 6:78373747-78373769
Sequence CCACTACCACCAACCCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010644800_1010644806 8 Left 1010644800 6:78373747-78373769 CCTCCATGGGTTGGTGGTAGTGG No data
Right 1010644806 6:78373778-78373800 GGGAGAAGCTCCTCTGCTTGTGG No data
1010644800_1010644807 15 Left 1010644800 6:78373747-78373769 CCTCCATGGGTTGGTGGTAGTGG No data
Right 1010644807 6:78373785-78373807 GCTCCTCTGCTTGTGGAAAGAGG 0: 9
1: 76
2: 265
3: 395
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010644800 Original CRISPR CCACTACCACCAACCCATGG AGG (reversed) Intergenic
No off target data available for this crispr