ID: 1010644806

View in Genome Browser
Species Human (GRCh38)
Location 6:78373778-78373800
Sequence GGGAGAAGCTCCTCTGCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010644795_1010644806 28 Left 1010644795 6:78373727-78373749 CCACAAGCTGACTGAAGAAACCT No data
Right 1010644806 6:78373778-78373800 GGGAGAAGCTCCTCTGCTTGTGG No data
1010644800_1010644806 8 Left 1010644800 6:78373747-78373769 CCTCCATGGGTTGGTGGTAGTGG No data
Right 1010644806 6:78373778-78373800 GGGAGAAGCTCCTCTGCTTGTGG No data
1010644802_1010644806 5 Left 1010644802 6:78373750-78373772 CCATGGGTTGGTGGTAGTGGTGG No data
Right 1010644806 6:78373778-78373800 GGGAGAAGCTCCTCTGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010644806 Original CRISPR GGGAGAAGCTCCTCTGCTTG TGG Intergenic
No off target data available for this crispr