ID: 1010644807

View in Genome Browser
Species Human (GRCh38)
Location 6:78373785-78373807
Sequence GCTCCTCTGCTTGTGGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1288
Summary {0: 9, 1: 76, 2: 265, 3: 395, 4: 543}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010644800_1010644807 15 Left 1010644800 6:78373747-78373769 CCTCCATGGGTTGGTGGTAGTGG No data
Right 1010644807 6:78373785-78373807 GCTCCTCTGCTTGTGGAAAGAGG 0: 9
1: 76
2: 265
3: 395
4: 543
1010644802_1010644807 12 Left 1010644802 6:78373750-78373772 CCATGGGTTGGTGGTAGTGGTGG No data
Right 1010644807 6:78373785-78373807 GCTCCTCTGCTTGTGGAAAGAGG 0: 9
1: 76
2: 265
3: 395
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010644807 Original CRISPR GCTCCTCTGCTTGTGGAAAG AGG Intergenic
900168430 1:1254377-1254399 CCTCCTATGCTGGTGGAAGGCGG - Intronic
900941519 1:5801664-5801686 GCACCCCGGCTTGTGGAGAGTGG - Intergenic
901854946 1:12038596-12038618 CCCCCTCTGCCTTTGGAAAGTGG + Intergenic
902120277 1:14159346-14159368 GCTCTTCTGCCCTTGGAAAGGGG - Intergenic
902143822 1:14379648-14379670 GTTCCTCTGCCTGTGGAAAGGGG + Intergenic
902219100 1:14953359-14953381 GCTCCTCTCCTTTTGGAAGGTGG + Intronic
905414849 1:37796725-37796747 ACTCCTCTGTTTGTGGCAGGTGG + Exonic
906352925 1:45079370-45079392 GCTCCTCTGCCTTTGGAAAGGGG - Intronic
906827006 1:48992722-48992744 AGGCCTCTGCTTATGGAAAGGGG - Intronic
906870681 1:49476973-49476995 ACTTCTCTGCCTGTGGAAAGGGG + Intronic
907004199 1:50893932-50893954 GCTCCTCTTCCTATGGAAAGGGG - Intronic
908175522 1:61552090-61552112 ACTCCTCTGCTTCAGGAAAGGGG - Intergenic
908598938 1:65718544-65718566 GCTCCTCTGTCTTTGGAAAGGGG - Intergenic
908908046 1:69038600-69038622 GCTACTCTGCTTTTGATAAGGGG + Intergenic
909128633 1:71707404-71707426 GCTCCTCTGCCTTTGGAAAGGGG + Intronic
909182265 1:72439559-72439581 GCTCTTTTGCCTTTGGAAAGGGG - Intergenic
909270429 1:73617230-73617252 GCTTGTCTGCCTTTGGAAAGTGG - Intergenic
909271358 1:73627401-73627423 AATCCTCTGCTTGTGAAAAGTGG + Intergenic
909309539 1:74129320-74129342 ACTTCTCTGCTTGTGGGTAGAGG - Intronic
909316308 1:74223771-74223793 GTTCCTCTGCCTATGGAAAGGGG + Intronic
909384018 1:75035389-75035411 GATCCTCTGCCTTTGGAAAAGGG + Intergenic
909420695 1:75461828-75461850 ACTCCTCTGCCTTTGGAAAGGGG + Intronic
909431344 1:75590708-75590730 GTTCCTCTGCCTTTGGAAAAGGG + Intronic
909848758 1:80433818-80433840 GCTCTTATGCCTATGGAAAGAGG - Intergenic
910167322 1:84341288-84341310 GCTCCTCTGCTTGGGGTAGATGG + Intronic
910289831 1:85589083-85589105 GCTCCTCTTCCTCTGAAAAGGGG + Intergenic
910349242 1:86277267-86277289 GCTCCTCTGCCTGTGGAAAGGGG - Intergenic
910488878 1:87746189-87746211 GCTCCTCTGCCAGTGGAACTTGG - Intergenic
910546682 1:88426105-88426127 GCTCCTCTGCCTGCGGAAAGTGG + Intergenic
910716341 1:90235700-90235722 GCTCCTATGTCTGTGGAAAGTGG - Intergenic
910733178 1:90421164-90421186 GCTCCTCTGCCTTTGGAAAAGGG + Intergenic
911019909 1:93375696-93375718 ACTCCTCTGCTTGTAGAAAGAGG + Intergenic
911241323 1:95470752-95470774 GCTCTTTTGCCTGTGTAAAGGGG - Intergenic
911373719 1:97024892-97024914 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
911536470 1:99106191-99106213 GCTTCTTTGCCTTTGGAAAGGGG + Intergenic
911853062 1:102842715-102842737 GCTCCTCTGCCTTTCAAAAGGGG + Intergenic
911887805 1:103326412-103326434 CCTCATCTGCCTTTGGAAAGGGG - Intergenic
911965081 1:104358223-104358245 GCTCCTTTGCTTGTTCAAATTGG + Intergenic
912015395 1:105027758-105027780 ACTCTTCTGCTTGTGGAAAAGGG + Intergenic
912034944 1:105301147-105301169 GCTCCTCTGCCTTTGAAAACTGG - Intergenic
912059051 1:105641641-105641663 GCTCCTCTGCCTTTGAAAATGGG + Intergenic
912070827 1:105807100-105807122 TCTCCTCTGCCTTTGGAAAGGGG + Intergenic
912127377 1:106555568-106555590 GCTCCTCTGCCTATGGAAAGGGG + Intergenic
912152809 1:106880484-106880506 GCTCCTCTGCCTGTGGAAAGAGG + Intergenic
912242708 1:107927684-107927706 GCTCCTCTGCCTGTGGAAAGGGG + Intronic
912601178 1:110934598-110934620 GCTCCTCCGCCTTTGGAAAGGGG + Intergenic
912871589 1:113311543-113311565 ACTCCTCTGCTTGTGGAAATGGG + Intergenic
912873071 1:113327810-113327832 ACTCCTCTGCCTGGGAAAAGGGG - Intergenic
912906631 1:113714536-113714558 ATTCCTCTGCTTGAGGAAACGGG + Intronic
913706966 1:121434762-121434784 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
914461688 1:147891100-147891122 CCTCCTCTGCCTCTGGTAAGAGG + Intergenic
915164646 1:153941837-153941859 GCTCCTCTGCCATTGGGAAGGGG - Intronic
915444202 1:155965606-155965628 GAGCCTCTGTTTGGGGAAAGGGG - Intronic
915810930 1:158909861-158909883 ACACCTCTGCTTGTGGAAACAGG + Intergenic
916121288 1:161530652-161530674 GCCCCTCTGCTTCTGTAGAGGGG + Intergenic
916131055 1:161612257-161612279 GCCCCTCTGCTTCTGTAGAGGGG + Intronic
917061651 1:171048386-171048408 GCTCCTCTGCCTTTGGAGAGGGG - Intronic
917176998 1:172246314-172246336 GCTCCTCTGATTGCAGCAAGTGG - Intronic
917246266 1:173004670-173004692 GCTCCTCTGCCTGTGGAACAGGG - Intergenic
917373038 1:174316884-174316906 GTTCCTCTGCCTTTGGAAAGTGG - Intronic
917387218 1:174490808-174490830 GCTCCTCTGCTTGTGGAAAGAGG - Intronic
917986569 1:180326258-180326280 GCTCCTCTGCCTGTGGAAAAGGG - Intronic
918358053 1:183724571-183724593 ACTCCTCTGCTTGTGGAAGGGGG + Intronic
918416180 1:184310872-184310894 GCTCCTCTGCTTTTGGTAAGGGG - Intergenic
918666173 1:187154227-187154249 GCTCCTGTGCCTTTGGAAAGGGG - Intergenic
919003184 1:191860738-191860760 GCTTCTCTTCCTTTGGAAAGGGG + Intergenic
919008524 1:191929611-191929633 GCTCTTCTGCCTTTGGAAAGGGG + Intergenic
919129883 1:193438428-193438450 GCTCCTCTGCCTGTGGAAAGGGG - Intergenic
919373556 1:196763296-196763318 GCTCCTCTGACTTTGGAAAGGGG - Intergenic
919379996 1:196847973-196847995 GCTCCTCTGACTTTGGAAAGGGG - Intronic
919478029 1:198053741-198053763 GCTCCTCTGCCTGTCAACAGGGG - Intergenic
920549638 1:206847450-206847472 GCTCTCCTGCCTTTGGAAAGCGG + Intergenic
920594877 1:207259233-207259255 GCTCCTCTGCCTATGGAAAGGGG - Intergenic
920850520 1:209625216-209625238 GCACCTCTGCTGGTGGGATGGGG + Intronic
920921220 1:210298773-210298795 GCTCTTCTGCTTGTGGAGCCTGG + Intergenic
921296104 1:213705360-213705382 GATCCTCTGCCTTTGGAAAGGGG - Intergenic
921929316 1:220742258-220742280 GCTCCTCTGCCTGTGGAAAGGGG - Intergenic
922323784 1:224510261-224510283 GCTCCTTTGCATGGGGAATGGGG - Intronic
922377197 1:224980386-224980408 TTTCCTCTGCCTGTGGAGAGAGG + Intronic
922551669 1:226498706-226498728 GGTCCTCTTCTTGGGGACAGAGG - Intergenic
922642321 1:227246212-227246234 CCTCCTCTGCATGTGGAAAGGGG + Intronic
922746128 1:228045226-228045248 GCTCCTGAGCTTCTGGTAAGAGG - Intronic
923540399 1:234884581-234884603 TCTCCTCTGCATGTGCCAAGTGG - Intergenic
923960137 1:239071929-239071951 CAACCACTGCTTGTGGAAAGTGG + Intergenic
924516133 1:244767957-244767979 AATCCTCTGCCTGTGGAGAGGGG - Intergenic
924648957 1:245905484-245905506 GCTCCTGTGCCTTTGGAAAAAGG + Intronic
924792813 1:247269105-247269127 GGTCCTCTGCCTTTGGAAAAGGG - Intergenic
924833821 1:247628319-247628341 GCTCCTCTGCCTGTGGAAAATGG - Intergenic
1063119188 10:3092853-3092875 GCTCCCCTGTCTGAGGAAAGGGG + Intronic
1063522997 10:6757960-6757982 GCTCATCTGCTTGTGGAGCCTGG + Intergenic
1064330723 10:14391699-14391721 GCTCCTTAGCTTGGAGAAAGGGG - Intronic
1064709519 10:18109335-18109357 GCTCCTCTGCTTCTGGAACCTGG - Intergenic
1064987456 10:21225624-21225646 ACTCCTCTGCTTGTGGAAAAGGG - Intergenic
1065317190 10:24474521-24474543 TCTCATCTGGTTGTGGGAAGTGG + Intronic
1065381474 10:25095759-25095781 GCTCTTCTTCCTTTGGAAAGGGG - Intergenic
1065426840 10:25615143-25615165 GCTCCTCTGCCTATGGAAAGGGG - Intergenic
1065467708 10:26043555-26043577 GCTCCTCTGCCTGTGGAAAGGGG - Intronic
1066084564 10:31963516-31963538 GCTCCTCTCCTATTGGAAAGGGG + Intergenic
1066708289 10:38204252-38204274 ACTACTCTGCCTGGGGAAAGGGG + Intergenic
1066981220 10:42418330-42418352 ACTACTCTGCCTGGGGAAAGGGG - Intergenic
1068392339 10:56414402-56414424 ACTCCTCTACTTGTGAAAAGGGG - Intergenic
1068411328 10:56659955-56659977 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1068422096 10:56807871-56807893 GCTGCTCTGATTTTGGAAACAGG - Intergenic
1068497927 10:57808562-57808584 GCTCATCTGCTTGTGGAGCCTGG + Intergenic
1069193408 10:65519252-65519274 ACTCTTCTGCTTGTGCAAATGGG - Intergenic
1069248860 10:66244155-66244177 GCTCCTCTGCCTATGGAAAGAGG + Intronic
1069395019 10:67978375-67978397 GTTCCTCTGCCTTTGCAAAGGGG + Intronic
1069863283 10:71484435-71484457 GCTCCTCTGAGTCTGGAAAAAGG - Intronic
1069933519 10:71899809-71899831 GCTCCTCTGCCTTTAGAAAGGGG - Intergenic
1070059331 10:72967317-72967339 GCTCCTCTGCTTGCAGAAAGGGG - Intergenic
1070477590 10:76845466-76845488 GCTCCTCTGCCTGTGGAAAAGGG + Intergenic
1070915086 10:80148354-80148376 GCACCTCTGCCTTGGGAAAGCGG + Intergenic
1071209214 10:83318056-83318078 GCTCTTCTCCTTTTGGAAAGGGG + Intergenic
1071869684 10:89780727-89780749 GCTCCGCTCCCTTTGGAAAGGGG - Intergenic
1071899285 10:90101606-90101628 GCTCCTCTGCCTGTAGAAAATGG + Intergenic
1071963039 10:90824777-90824799 ACCCCTCTTCTTGTGGAAGGGGG + Intronic
1072083657 10:92057354-92057376 ACTCCTCTGCCTTTGGAAAGGGG + Intronic
1072640004 10:97204825-97204847 GCTCCTCTCCCTGTGGGAAGTGG - Intronic
1072655614 10:97328234-97328256 GCTCATCTGGGTGTGGAGAGAGG + Intergenic
1072843081 10:98796429-98796451 GCTCCTCTGCCTGTGAAAAGCGG + Intronic
1072862750 10:99023252-99023274 GCTCCTCTGTCTTTGGAAATGGG + Intronic
1072877729 10:99191031-99191053 ACTCCTCTGCTTGAAGAAAGGGG + Intronic
1073708150 10:106010443-106010465 GCTCCTCTGCTTATGGAAAGGGG - Intergenic
1073823342 10:107291162-107291184 GCACCTCTGCCTTCGGAAAGGGG - Intergenic
1074038148 10:109761679-109761701 GCTCCTCTGCCAGTGGAAAGGGG - Intergenic
1074302102 10:112242213-112242235 ACTCCTCTGCTTGTGGAAGTGGG - Intergenic
1074408527 10:113202054-113202076 GCTCTTCTGCCTGTGGAAATGGG + Intergenic
1074638056 10:115344370-115344392 GCTCTTCTGCCTTTGGAAAAGGG - Intronic
1075194993 10:120348550-120348572 GCTCCTCTGCCTGTGGAATAGGG + Intergenic
1077709713 11:4523562-4523584 GCTCGTCTGCCTTTGGAAAGGGG + Intergenic
1077835550 11:5923767-5923789 GCTTTCCTGCCTGTGGAAAGGGG + Intronic
1078534386 11:12161381-12161403 CCTCCTCCGCCTGTGCAAAGGGG - Intronic
1078741457 11:14070409-14070431 GTTTCTTTGCTTGTGGAAGGAGG - Intronic
1078992691 11:16665442-16665464 ACTCCTCTGCTTGTGGACTAAGG + Intronic
1079037983 11:17037192-17037214 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
1079069187 11:17328540-17328562 GGTCCTCTGCCTGTGGAAAGAGG - Intronic
1079256599 11:18836410-18836432 GCTCCTCTTCTCCTGCAAAGTGG + Intergenic
1079517019 11:21281310-21281332 GCTCCTCTGCCTGTGGAAACGGG + Intronic
1079538098 11:21539676-21539698 GCTCATCTGCTTGTGGAGCCTGG + Intronic
1079571921 11:21953428-21953450 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
1079688933 11:23398310-23398332 ACTCCTCTGCTTGTGGAAAGAGG + Intergenic
1079712902 11:23708552-23708574 GCTCCTCTGCCTTTAGAAAAGGG + Intergenic
1079729262 11:23920398-23920420 GCTAGTCTGCCTTTGGAAAGGGG - Intergenic
1079823341 11:25159845-25159867 GCTCCTCTGCCTTTGGGAAACGG - Intergenic
1080084153 11:28258614-28258636 GCTCCTCTGCCTTTGGAAAGGGG - Intronic
1080481980 11:32661085-32661107 GATCCTCTGGTTGGAGAAAGGGG + Intronic
1080800733 11:35607937-35607959 GCTCTTCTGCTTATTGAAACAGG + Intergenic
1081049216 11:38316276-38316298 ACTCCTCTGCTTGAGGAAAGGGG + Intergenic
1081073663 11:38642097-38642119 ACTCCTTTGCTTGTGGAAAAGGG - Intergenic
1081079245 11:38718967-38718989 GATCCTTGGCTAGTGGAAAGTGG - Intergenic
1081112110 11:39149141-39149163 ACTTCTCTGCCTTTGGAAAGGGG + Intergenic
1081967397 11:47178038-47178060 GCTCCTCCCCTGGGGGAAAGGGG + Exonic
1082245596 11:49918624-49918646 GATTTTCTGTTTGTGGAAAGGGG - Intergenic
1083505766 11:63156285-63156307 GCTTCTCTGCCTTTGAAAAGGGG - Intronic
1083512722 11:63226884-63226906 ATTCCTCTTCTGGTGGAAAGGGG - Intronic
1083528771 11:63397620-63397642 ACTCCTCTGCTTGTGGAAAAGGG - Intronic
1084020483 11:66414289-66414311 GCTGCTCTGCATTTGAAAAGTGG + Intergenic
1084681058 11:70666629-70666651 TCTCATCTGCATGTGGAGAGTGG - Intronic
1085223513 11:74896426-74896448 GCTCCTCTGCCTGTGGAAAGGGG + Intronic
1085437432 11:76520964-76520986 TTTCCTCTGCTTATGAAAAGAGG - Intronic
1085981593 11:81732857-81732879 GCTCCTCTGCCTTTGGAATGGGG - Intergenic
1086007055 11:82049119-82049141 GCTCCTCTGCCTTTGGAAAGAGG + Intergenic
1086406038 11:86499653-86499675 ATTCCTCTGCTTCTGGAAAAGGG + Intronic
1086468135 11:87076273-87076295 GCTCCTCTGCCTGTGGAAAGGGG - Intronic
1086838189 11:91652623-91652645 GCTCCTCTGCCTATGGAAAGGGG - Intergenic
1087178586 11:95119906-95119928 GCTCCTCTGCCTTTGGAAAGGGG - Intronic
1087299359 11:96414018-96414040 ACTCCTCTTCATGGGGAAAGGGG + Intronic
1087313325 11:96576885-96576907 ACTTCTCTGCCTGGGGAAAGGGG - Intergenic
1087417091 11:97871323-97871345 GAGCCTCTGCCTGTGGAAAGGGG - Intergenic
1087468324 11:98539005-98539027 TCTCATCTGCCTGTGAAAAGAGG + Intergenic
1087532886 11:99406793-99406815 GCTCCTCTGCCTTTGAAAATGGG - Intronic
1087876998 11:103370221-103370243 GCTCCTCTGCCTTTGGAAAGGGG + Intronic
1087950761 11:104218474-104218496 GTTTCTCTGCTTGTGGGAAGGGG - Intergenic
1088154792 11:106790231-106790253 CCTCCTCTGCCTGTGGAAAGGGG - Intronic
1088717043 11:112557964-112557986 GCTTTTCTGCTTGTGGTAGGAGG + Intergenic
1088938162 11:114425678-114425700 GCTCCTGTGCCTGTGGAAAGTGG - Intronic
1089199406 11:116714784-116714806 GCTCCACTGAGTGTGGAGAGGGG + Intergenic
1089946577 11:122480074-122480096 GTCCCTCTGCCTATGGAAAGGGG + Intergenic
1090042752 11:123305031-123305053 GCGCCCCTGCTTGTAGAAAGCGG + Intergenic
1090318233 11:125816959-125816981 GCTCCTCTGCTTTTGGAAAGGGG - Intergenic
1090515622 11:127423596-127423618 GTTTCTCTGCATATGGAAAGGGG - Intergenic
1090676841 11:129006968-129006990 GCTCCTCTGCCTATGGAAAGGGG - Intronic
1090836821 11:130459961-130459983 GCTTCTTTGCCTGTGGAAGGTGG + Intronic
1091684121 12:2549570-2549592 GCTCCTCTTTCTGTGGCAAGTGG + Intronic
1093123976 12:15306692-15306714 ATTCCTCTGCCTTTGGAAAGGGG - Intronic
1093124521 12:15312883-15312905 GTTCCACTGCTTTTGGAAAGCGG - Intronic
1093244358 12:16717879-16717901 ACTCTTCTTCTTTTGGAAAGAGG + Intergenic
1093588559 12:20872125-20872147 GCTCCTCTGCCTGTGGCAAGGGG - Intronic
1093620112 12:21278152-21278174 GCTCCTCTGACTTTGGAAAGGGG + Intronic
1093931860 12:24961726-24961748 ACTCCTCTGCTTGTAGAAAGGGG + Intergenic
1093991167 12:25591411-25591433 GCTCCTCTGCCTTTGGAAAGGGG + Intronic
1094150523 12:27277877-27277899 GCTCATCTATTTGTGGAAAGAGG - Intronic
1094258622 12:28465115-28465137 GCTCCTCTACCTTTGGAAAGGGG + Intronic
1094380706 12:29840370-29840392 GCTCCTCTGCCTGTGGAAAGGGG - Intergenic
1094655846 12:32418954-32418976 GATCTTCTGCCCGTGGAAAGGGG - Intronic
1094658138 12:32440887-32440909 GCTCTTCTGCCTTTGGAAAAGGG - Intronic
1095101083 12:38184432-38184454 GCTCCTCTGCCTGCAGACAGGGG + Intergenic
1095133697 12:38572352-38572374 GCTTCTCTGCCTTTGGAAATGGG + Intergenic
1095163382 12:38942092-38942114 ACTCTTCTGCCTGTGGAAATGGG + Intergenic
1095639834 12:44475353-44475375 GTTCCTCAGCCTTTGGAAAGGGG - Intergenic
1095808086 12:46343225-46343247 ACTCCTCTGCTTGGGGAAAGGGG - Intergenic
1096343895 12:50828503-50828525 GCTCCGTTGCCTGTGGAAAATGG - Intergenic
1096954900 12:55516300-55516322 GGTCCTCTGACTGTGGAAAGGGG + Intergenic
1097473188 12:60021382-60021404 GCTCCTCTACCTTTGGAAAGAGG - Intergenic
1097508683 12:60507982-60508004 GCACCTCTGCCTGTAGAAAAGGG + Intergenic
1097563582 12:61239492-61239514 GTTCTTCTGCCTTTGGAAAGAGG - Intergenic
1097568937 12:61307670-61307692 ACTCTTCTGCATATGGAAAGGGG - Intergenic
1097714763 12:62954679-62954701 GATCCTCTGCATGTGGAAAGAGG - Intergenic
1097769979 12:63572327-63572349 ACCCCTCTGCCTGGGGAAAGGGG + Intronic
1097899203 12:64856832-64856854 GCTCTTCTGCCTGTGGTATGGGG - Intronic
1098395358 12:70011227-70011249 GCTCCCCTGCCTATGGAAAGGGG + Intergenic
1098405746 12:70123979-70124001 GCTCCTGTACTTGTGGAAAGGGG + Intergenic
1098649019 12:72941138-72941160 ACTCCTCTGCTTGAGCAAAGGGG - Intergenic
1098736538 12:74112439-74112461 ACTCCTCTGCCTGAGGCAAGGGG - Intergenic
1099433832 12:82619971-82619993 CCTCGTCTGCCTTTGGAAAGGGG + Intergenic
1099491430 12:83292919-83292941 ACTCCTCTGCTTGTGTAAAGGGG + Intergenic
1099495368 12:83339931-83339953 GCTCCTCTGCCTTTGGTAAGTGG + Intergenic
1099610043 12:84857003-84857025 GCTCCTCTGACTGAGGAAAGAGG - Intergenic
1099616187 12:84938588-84938610 GCTTCTCTGCTTGTGTAAAGGGG + Intergenic
1099882304 12:88480933-88480955 GCTCCTCTGTCTGTGGAAAAGGG + Intergenic
1100478098 12:94952570-94952592 TCTCATCTGCTTGTGGAACCTGG - Intronic
1100858484 12:98779340-98779362 ATTCCTCTGATTGTGGAGAGTGG + Intronic
1100875764 12:98959887-98959909 ACTCCTCTGTTTGTGGAAAGGGG + Intronic
1100946453 12:99788869-99788891 TCTCCTCTGCCTGTGGAAAAGGG + Intronic
1100978520 12:100146190-100146212 GCTCATCTGCTTGTGGAGCCTGG + Intergenic
1101162575 12:101994091-101994113 GCTCCTCTGCCTGTAGAAATGGG - Intronic
1101251924 12:102945538-102945560 ACCCCTCTGTTTGTGGAAAGGGG - Intronic
1103220000 12:119236097-119236119 GCTCACCTTCTAGTGGAAAGAGG + Intergenic
1103461443 12:121107985-121108007 GTTCCTCTGACTGAGGAAAGGGG + Intergenic
1103575283 12:121872715-121872737 GATCTTCTGCTTGAGAAAAGAGG + Intergenic
1104075442 12:125385361-125385383 GCTCCTCTGATTTTGGGAGGAGG + Intronic
1105299251 13:19117882-19117904 GCTGCTCTGCCTGTGGTAGGGGG - Intergenic
1105336335 13:19473447-19473469 GCTCCTCTGCCTTTGGACAGGGG - Intronic
1105558979 13:21473011-21473033 ACTCCTCTGCCTGGGGAAAGGGG - Intergenic
1106074833 13:26448975-26448997 AATCCTCTGCTTGAGGAAAGGGG + Intergenic
1106242219 13:27921098-27921120 GCTGCCCTGGTTGTGGAAACAGG + Intronic
1106645465 13:31629539-31629561 GCTCCTCTGCTTTTGGAAAGAGG - Intergenic
1106896049 13:34303122-34303144 GCTCCTCTAGCTTTGGAAAGGGG + Intergenic
1106964018 13:35038107-35038129 GCTCCTCAGCCTTTGGAAAGGGG - Intronic
1107083904 13:36405352-36405374 GCTACTCTGCCTTTGGAAAAAGG - Intergenic
1107287727 13:38814805-38814827 GCTCCTCTGACTGCGAAAAGGGG - Intronic
1107524156 13:41213778-41213800 GCCCCTCTGCTTGTGGAAAGGGG - Intergenic
1107807815 13:44171655-44171677 GCTCCTCTGCTTTTGGAAAGAGG - Intergenic
1107808184 13:44174469-44174491 ACTCCTCTGCTTGAGGAAAGGGG - Intergenic
1108579864 13:51819164-51819186 GCACCTCTCCTTGTGCATAGGGG - Intergenic
1108631632 13:52289355-52289377 GCTCCTCTGCTTTTGGAGAGGGG - Intergenic
1108655059 13:52523240-52523262 GCTCCTCTGCTTTTGGAGAGGGG + Intergenic
1108858086 13:54820317-54820339 GAGACTCTACTTGTGGAAAGAGG + Intergenic
1108862797 13:54882608-54882630 CCTCCTCTGCTTTTGTCAAGAGG + Intergenic
1108973069 13:56401694-56401716 ACTCTTCTGTTTGTGGAAAGAGG + Intergenic
1109100657 13:58180607-58180629 ACTCCTCTGCTTGTGGGAAGGGG - Intergenic
1109184459 13:59252340-59252362 GCTCCTCTGCCAGTGGAACCTGG + Intergenic
1109336638 13:61003225-61003247 GTTCCTCTGCCTGTGAAAAGGGG - Intergenic
1109583547 13:64370762-64370784 GCTCCTCTGCCTTTGGAAAGCGG - Intergenic
1109685891 13:65819180-65819202 GCTCCTCTTTCTTTGGAAAGGGG + Intergenic
1110078890 13:71286440-71286462 ATTCCCCTGCTTGTGGAAAGGGG - Intergenic
1110501356 13:76231746-76231768 GCTCCTCTGCCTTTGGAAAGAGG + Intergenic
1110889475 13:80680251-80680273 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1110974235 13:81808758-81808780 GCTCCTTTGCCTGTGGAACTGGG + Intergenic
1111365176 13:87234240-87234262 GCTCCTCTGCCTTTGGAAAAGGG - Intergenic
1111467449 13:88633708-88633730 AGTCCTCTTCTTGTGGAGAGAGG - Intergenic
1111542766 13:89689869-89689891 GCTCCTCTGCCTGTGGAATGGGG + Intergenic
1112053747 13:95670982-95671004 ACTCCTCTGCCTGGTGAAAGAGG - Intergenic
1112618823 13:101034422-101034444 GCTCCTTTGCCTTTGGAAAGGGG - Intergenic
1112901440 13:104362791-104362813 ACTCCTCTGCTTTTGGAAAGGGG - Intergenic
1113212880 13:108003077-108003099 GATCCTCTGGCTGTGGAAAGGGG - Intergenic
1113253988 13:108486754-108486776 GCTCTTCTGCTTGCAGAAAGGGG + Intergenic
1113730039 13:112635129-112635151 GATCCTGTGCTGGGGGAAAGAGG - Intergenic
1114072610 14:19126750-19126772 GCTCCTCAGCTTTTGGAAAGGGG - Intergenic
1114089646 14:19273222-19273244 GCTCCTCAGCTTTTGGAAAGGGG + Intergenic
1114506327 14:23217265-23217287 GCTCCTCTGCCTGTGGAAAGGGG + Intronic
1114761541 14:25321921-25321943 GCTCCATTGCCTGTGGAAAGGGG - Intergenic
1114783675 14:25569890-25569912 GCTTCTCTGCCTGTGGAAAGGGG - Intergenic
1114968991 14:28001938-28001960 GGTCCTCTGCCTGTGGAAAGGGG + Intergenic
1114985084 14:28217137-28217159 GCTCCTCCACTTGTGAAAATTGG - Intergenic
1114987925 14:28252846-28252868 GTTCCTTTGCCTTTGGAAAGGGG - Intergenic
1115133962 14:30086734-30086756 GCTCCTCTGCCTGTGGAAAGGGG + Intronic
1115381568 14:32745910-32745932 GCTCCCCTGGTTTTGGAAAGGGG - Intronic
1115620279 14:35134219-35134241 GCTCCTCTGCTTTTGGAAACGGG - Intronic
1115821049 14:37212481-37212503 GCGCCTCTGCCTTTGGAAAGGGG + Intronic
1115861252 14:37688201-37688223 GCTTCTCTGCTTTTGAAAAGTGG + Intronic
1116021585 14:39468622-39468644 GATCCTCTGCCTGTGGAAAGTGG - Intergenic
1116057929 14:39886287-39886309 GCTTCTCTGCCTTGGGAAAGGGG + Intergenic
1116106499 14:40514330-40514352 GCTCCTCTGACTGCGTAAAGGGG + Intergenic
1116121947 14:40731994-40732016 GCTCCTTTGCCTTTGGAAAGGGG - Intergenic
1116192638 14:41680018-41680040 ACCCCACTGCTTGTGGACAGGGG + Intronic
1116275537 14:42827269-42827291 ACTCCTCTGCTTGAGGAAATAGG - Intergenic
1116354876 14:43915092-43915114 ACTTTTCTGCTTGAGGAAAGAGG + Intergenic
1116434104 14:44877491-44877513 CTTCCTCTGCCTGTGGAAAGGGG + Intergenic
1116481128 14:45392402-45392424 GAGCCTCTGCCTGTGGAAAGGGG + Intergenic
1116497745 14:45582981-45583003 ACTCCTCTGCCTGAGGAAAGTGG - Intergenic
1116504785 14:45665124-45665146 GCTTCTCTGCCTTTGGAAAGGGG - Intergenic
1116669391 14:47821648-47821670 GCTCCTCTGCCTGTGGAAAAGGG - Intergenic
1116889185 14:50250395-50250417 GCCCCTCTGCCTGTGGAAAGGGG + Intronic
1117159324 14:52973410-52973432 GCTCCTGTGCCTTTGGAAAAGGG - Intergenic
1117264870 14:54076542-54076564 ACTCCTCTGCCTTTGAAAAGGGG - Intergenic
1117418419 14:55519343-55519365 GCTTCTTTGACTGTGGAAAGGGG + Intergenic
1118084355 14:62398424-62398446 ACTCCTCTGCCTATGGAAAGGGG - Intergenic
1118956707 14:70489303-70489325 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
1119281962 14:73416943-73416965 GCTCTTCTGCTTGTGGAGCCTGG - Intronic
1120275831 14:82371119-82371141 GCTCCTCTTCCTGGGGAAAGGGG + Intergenic
1120714118 14:87822028-87822050 TCCCCTCTGCTAGTGGAGAGGGG + Intergenic
1121815555 14:96925534-96925556 GGACCTCTGCTTCTGGATAGGGG - Intronic
1122146328 14:99691096-99691118 CCTCCCCTGCTTTTGGAAAAAGG + Exonic
1124844224 15:33275069-33275091 GCTCCTCTACTTTTGGAAAGTGG - Intergenic
1125044439 15:35230260-35230282 GCTCCTCTGCCTTTGGAAAGGGG - Intronic
1125272346 15:37952969-37952991 GCATCTCTGCTTTTGGAAAGGGG + Intronic
1125276944 15:38003637-38003659 ACTCATCTGCTTGAGAAAAGAGG - Intergenic
1125567107 15:40685192-40685214 ACTCTTCTACTTGAGGAAAGAGG - Intergenic
1126053269 15:44706992-44707014 ACTCCTCAGCTTGTGGAAAGGGG - Intronic
1126250730 15:46565413-46565435 GCTCCTCTGCCATTGGAAATGGG - Intergenic
1126285746 15:47008953-47008975 ACTTCTCTGCTTGAGAAAAGGGG - Intergenic
1126294922 15:47129472-47129494 GCTCCTATGCCTTTGGAAAGGGG - Intergenic
1126440600 15:48683898-48683920 AGTCCTCTGCCTGGGGAAAGTGG + Intergenic
1126503839 15:49380119-49380141 GCGCCTCTGCCTTTGGAAAGGGG - Intronic
1126534200 15:49742660-49742682 GCTCCTCTGCGTGTGGAAAGGGG + Intergenic
1126709392 15:51440870-51440892 GCTCCTCTCCCTTTGGAAAGGGG - Intergenic
1126793628 15:52242774-52242796 GTTATTCTGCTTGGGGAAAGTGG + Intronic
1127022233 15:54760717-54760739 GCTCCTCTGCCTATGAAAAGGGG + Intergenic
1127035243 15:54908708-54908730 GCTCCTGTGCCTTTGGAAAGAGG + Intergenic
1127173541 15:56328687-56328709 TCTCCTCTGCTTGTGGAAAGGGG + Intronic
1127177962 15:56382097-56382119 GCTCCTCTGCCTGTGGAAAGGGG - Intronic
1127457308 15:59166935-59166957 GCTCCTCTCATTCTGGAAGGGGG - Intronic
1127831837 15:62757811-62757833 GCCCCTCCGCGTGTGGAAATGGG + Intronic
1127945213 15:63744586-63744608 GCTCCTCTAGCTTTGGAAAGGGG - Intronic
1127971469 15:63965692-63965714 ATGCCTCCGCTTGTGGAAAGGGG - Intronic
1128478158 15:68014866-68014888 GATCCTCTGCTTTTGCAAACTGG - Intergenic
1128607263 15:69046291-69046313 GCTTCTCTGCTTGGAGAAGGTGG + Intronic
1128901000 15:71422927-71422949 ACTCCTCTGCTTGCAGAAAGGGG - Intronic
1129835461 15:78702721-78702743 GCTCCTCCTCCTGTGGAATGGGG - Intronic
1129897431 15:79118817-79118839 GCTTCTCTGCCTGTAGAATGGGG - Intergenic
1130389588 15:83443838-83443860 GCTCCTCTGTTTAGGGAAGGGGG - Intergenic
1130441101 15:83955257-83955279 GCTCCTCTGCCTGTGGAAAGGGG - Intronic
1130511852 15:84595880-84595902 GCTCCTCTGCCTGTGGAAAGGGG + Intergenic
1131209023 15:90477259-90477281 GCCCCTCTGATAGTGGGAAGGGG - Intronic
1131315046 15:91328692-91328714 ACTCCTCTGCTTGAGGAAAGAGG - Intergenic
1131365716 15:91837559-91837581 GCTCTTCTGCTTGTGGATCCTGG + Intergenic
1131950123 15:97672984-97673006 GTTCCTCTGCCTTTGGAGAGAGG - Intergenic
1132584091 16:698586-698608 GCTCCTGTGCATGTGGAGGGTGG - Intronic
1133040278 16:3056981-3057003 CCGCCCCTGCTTGGGGAAAGGGG - Intronic
1133127342 16:3655536-3655558 GCTCCTCTGCTTTTGGGGGGAGG - Intronic
1134023585 16:10938544-10938566 GTTCCCCTGCTTATGGAAAGGGG + Intronic
1136280200 16:29203898-29203920 GCTCCTCTGCCTCTGGCACGTGG + Intergenic
1136676546 16:31913686-31913708 GCTCCTCTGCCTGCAGAAAGGGG - Intronic
1138638238 16:58361517-58361539 GCTTCTCTGCTTTTGGAAAGGGG - Intronic
1138806782 16:60099840-60099862 ACTCCTCTACTTGTGAAAAGGGG - Intergenic
1139103763 16:63801696-63801718 GATCCTCTGCCTTTGTAAAGGGG - Intergenic
1140593561 16:76381422-76381444 GATACTGTGCTAGTGGAAAGAGG + Intronic
1140646577 16:77038096-77038118 GCTCTTCTGCCTTTGGAAGGGGG - Intergenic
1140940479 16:79717463-79717485 GTTTCTCTGCTTCTGGAAAAGGG - Intergenic
1141485210 16:84334238-84334260 GCTCCTTTGCCTGTGGAAAGGGG + Intergenic
1142200751 16:88760082-88760104 GGACCTCTGCTTGTGGAGGGTGG - Intronic
1142961644 17:3555554-3555576 CCTCCTCTGCCTGGGGCAAGGGG - Intronic
1143327059 17:6106149-6106171 GCTTATGTTCTTGTGGAAAGAGG + Intronic
1143913449 17:10271431-10271453 CTACCTCTGCTTGTGGAAGGAGG + Intergenic
1144371341 17:14594458-14594480 GCTCATCTGCTTCTGGAGACTGG - Intergenic
1144492358 17:15724263-15724285 GCTGCTCTGTTTATGGGAAGAGG - Intergenic
1144908113 17:18654933-18654955 GCTGCTCTGTTTATGGGAAGAGG + Intronic
1145863985 17:28228389-28228411 GCTCCTCTGCTCGGGGAAAGGGG - Intergenic
1145888701 17:28399829-28399851 GCTTCTCAGCTTGGGGAAGGAGG - Exonic
1145995703 17:29103655-29103677 CCTCCACTGCCTGTGGAGAGAGG + Exonic
1146034164 17:29391031-29391053 GCACCTCTGCTTTGGGAAAGGGG + Intronic
1146242486 17:31243551-31243573 ACTCCTCTGCTTGAGAAAAGAGG - Intronic
1146749968 17:35369365-35369387 TCTCCTCTGCCTGTGGAAAAAGG + Intronic
1147926908 17:43952165-43952187 GCTCCTCTACTCAGGGAAAGGGG + Intergenic
1148137416 17:45303140-45303162 CCTCCACTGCTTGCGCAAAGGGG + Intronic
1148199742 17:45742108-45742130 GCACCTCTGTCTGGGGAAAGTGG + Intergenic
1149108571 17:52997981-52998003 GCTTCTCTGCTTTTGGAAATGGG + Intergenic
1149157306 17:53647483-53647505 GCTTATCTGCCTTTGGAAAGGGG - Intergenic
1149234951 17:54578574-54578596 GCTCCTCTGCCTTTGGAAAAGGG + Intergenic
1149239835 17:54635962-54635984 GCTCCTCTGCCTGTGGAAAGAGG + Intergenic
1149566688 17:57645317-57645339 GCCCCTTTGCTTCTGCAAAGTGG + Intronic
1150009001 17:61487667-61487689 CCTCCTCTCCTTGAAGAAAGAGG + Intergenic
1150864211 17:68832697-68832719 GCTCCTCTCCTTGAGGAATTGGG + Intergenic
1151043571 17:70893617-70893639 GCTTCTCTGCTAGGGGAATGTGG - Intergenic
1151414200 17:73951068-73951090 GCTTCTCTGCTGATGCAAAGAGG + Intergenic
1151770119 17:76155203-76155225 ACTCCTCTGGTTGTGGGAAGGGG + Intronic
1152388554 17:79989728-79989750 GCTGCTCTGCTTGTGCAGAGAGG - Intronic
1153074714 18:1148925-1148947 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
1153356544 18:4143354-4143376 GTTCTTCTGCTTGTGGAAAAGGG - Intronic
1153363361 18:4224605-4224627 ACGCCTCTGCTTGTGGAAAGGGG + Intronic
1153389149 18:4534630-4534652 TCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1153425788 18:4961460-4961482 GCTCCTCTGCCTTTGGCAAGGGG + Intergenic
1153429554 18:5000562-5000584 GCTCCTCTGCCTGAGTAAAGGGG + Intergenic
1153714989 18:7838907-7838929 GCACCTCTGCCTTTGGAAAGGGG - Intronic
1154407526 18:14107833-14107855 GCTCTTCTGCCTGTGGAATAAGG + Intronic
1154491181 18:14923409-14923431 GCTTCACTGCCTGTGGAAAGAGG + Intergenic
1155282191 18:24251013-24251035 GCTCCTGTGCCTGTGGAAAGGGG + Intronic
1155443468 18:25885446-25885468 ACTCTTCTGCTTTAGGAAAGAGG + Intergenic
1155533853 18:26795251-26795273 GCTCTTCTGCCTTTGGAAAGGGG + Intergenic
1155589174 18:27405241-27405263 GCTGCTCTGCATGTGCAGAGGGG + Intergenic
1155767443 18:29653064-29653086 ACTCCTCTGCCTGTGAAAAGGGG + Intergenic
1155782017 18:29849258-29849280 GCTCTTCTGCCTTTGGAAAGGGG - Intergenic
1156155901 18:34301361-34301383 TCTCCTCTGACTGTGAAAAGGGG + Intergenic
1156178239 18:34572821-34572843 GTTCATCTGCTTTGGGAAAGTGG + Intronic
1156912328 18:42425747-42425769 GCTCCTCTGACTGTGGAAAGAGG - Intergenic
1157065203 18:44341710-44341732 GCTCCTCTGCCTGGGGAAAAGGG - Intergenic
1157937029 18:51884289-51884311 ACTCCTCTGCCTGTGGAAAGGGG + Intergenic
1158024939 18:52885396-52885418 GCTCCTCTGTCTATGGACAGGGG - Intronic
1158302596 18:56068281-56068303 GCTCCTCTGCTGGGGGAGAGTGG - Intergenic
1158431341 18:57389998-57390020 GCTCCTCTGCCTTTGGAAAGAGG + Intergenic
1158481220 18:57823648-57823670 ACTCCTCTGCCTGGGGAAAGGGG - Intergenic
1158948954 18:62474453-62474475 ACTCATCTGCCTGTGGAAAGGGG - Intergenic
1159080682 18:63731838-63731860 CCTCCTCTGCCTGTGGAAAGGGG + Intergenic
1159091972 18:63860242-63860264 GCTCCTCTGCTTGTGGAAAGGGG - Intergenic
1159225178 18:65523868-65523890 ACTCCTCTGCTTGAAGATAGGGG + Intergenic
1159260269 18:66004635-66004657 ACTCCTCTGCTTGTGAAAAGGGG + Intergenic
1159565013 18:70038016-70038038 TCTCCTTTTCCTGTGGAAAGGGG + Intronic
1159731324 18:72032487-72032509 GCTCCTCTGCCTTTGGAAAGAGG - Intergenic
1159896443 18:74001380-74001402 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1160445745 18:78925744-78925766 CCTCCCCTGCTCGTGGAAACTGG - Intergenic
1161477976 19:4496766-4496788 CCTCCTCTGCTTGTGGACATTGG - Intronic
1162692967 19:12449202-12449224 GCTTCTCTGCCTGTGGAAAGGGG - Intronic
1162904772 19:13817199-13817221 GCAGCTCTGCAGGTGGAAAGAGG - Exonic
1163253940 19:16143633-16143655 GCTCACCTGCTTGAGGAAACAGG + Intronic
1164137361 19:22427267-22427289 CAACCTCTGCTTTTGGAAAGTGG - Intronic
1164491132 19:28715080-28715102 GCTCCTCTGCTTTTGGAAAGCGG + Intergenic
1164985018 19:32642057-32642079 GCTTGTCTGCTTGCGAAAAGTGG - Exonic
1165308071 19:35014176-35014198 CCTCCTCTGCCTGTGGAGAAAGG - Exonic
1165645471 19:37431936-37431958 ATTCCTCTGCCTGTGGAAAGGGG + Intronic
1165665198 19:37622013-37622035 ACCACTCTGCTTGTGGGAAGTGG - Intronic
1165983520 19:39747068-39747090 GCTTCTCTGCCTTTGGAAAGGGG + Intergenic
1167199566 19:48054986-48055008 CCTCTTCTACTTGGGGAAAGGGG + Exonic
1167582134 19:50351383-50351405 GCACCTCTGCCTGTGGCAAAGGG - Intronic
1168605757 19:57758871-57758893 ACACCTCTGCTTGTGAAAACAGG + Intergenic
1168615384 19:57833284-57833306 GCTGCTCTGCCTGTGGAAAGGGG - Intronic
1168621400 19:57882163-57882185 GCTGCTCTGCCTGTGGAAAGGGG + Intronic
925249615 2:2421424-2421446 ACTCCTCTGCCTTTGGAAAGCGG - Intergenic
925269492 2:2592125-2592147 GCTCCTCTGCCTACAGAAAGGGG + Intergenic
926834108 2:16998845-16998867 GCTCCACTGCCCATGGAAAGCGG - Intergenic
927570211 2:24152931-24152953 GATTCTCTGCCTGTGTAAAGGGG - Intronic
928066907 2:28174566-28174588 GCTCCTCAGTGTGGGGAAAGGGG + Intronic
928293599 2:30061536-30061558 GCTCCTCTGCCTGTGGAAAGGGG + Intergenic
928458933 2:31451252-31451274 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
928472241 2:31585946-31585968 GCTCCTCTGCCTTTGGACAGGGG + Intergenic
928932391 2:36637553-36637575 TTTTCTCTGCTTGAGGAAAGGGG + Intronic
929215182 2:39404485-39404507 GCTCCTCTGCCTGTGGAAAGGGG + Intronic
929281679 2:40087164-40087186 CTGCCTCTGCTTGTGGAAAGGGG - Intergenic
929388601 2:41442099-41442121 GCTCCTCTGCCTTTGGAAAGAGG - Intergenic
929524974 2:42693478-42693500 GCCCCTCTGCCTGTGGAAAGGGG - Intronic
929926504 2:46216809-46216831 GTTCCTCTGGCTTTGGAAAGGGG - Intergenic
930439622 2:51390170-51390192 GTTCCTCTGCCTGTGGAAAGGGG - Intergenic
930475509 2:51876206-51876228 GCTCCTCTGCCTATGGAAAGGGG + Intergenic
930492447 2:52092942-52092964 TCTCCTCTGCTTTTGGAAATGGG - Intergenic
930727456 2:54695636-54695658 ACTCCTCTGCCTTTGGAAAGGGG + Intergenic
930944832 2:57061301-57061323 GCTCCTGTGCCTGTGGAAAGGGG - Intergenic
930970250 2:57386208-57386230 GCTCCTCTGCCTGCAGAAAGAGG + Intergenic
931001835 2:57793804-57793826 GCTCCACTGCCTTTGGAAAAGGG - Intergenic
931012114 2:57929296-57929318 GCTGCTTTGCTTATGGAAAGGGG - Intronic
931572320 2:63681448-63681470 GCTCCTCTTCCTTTGGAAAGGGG + Intronic
931600793 2:64001116-64001138 GCTCCTCTGCCTGTGGAAAGGGG - Intronic
931989858 2:67779191-67779213 GCTCCTCTGACTTTGGAAAAGGG + Intergenic
933162914 2:79045427-79045449 GCTCCTCTGTTTTTGGAAATGGG + Intergenic
933298183 2:80514366-80514388 GCTCCTCTGTTCGTGGACAGTGG + Intronic
933523827 2:83410395-83410417 ACTCTTCTACTTGTGGAAATGGG - Intergenic
934715377 2:96539851-96539873 GCACATCTACTTGGGGAAAGGGG + Intronic
934870624 2:97861624-97861646 GATCTTCTGCCTGTGGAAAGGGG + Intronic
934929041 2:98405113-98405135 ACTCCTCTACTTGAGGAAATGGG + Intergenic
935356553 2:102206983-102207005 GCTCCTCTGCCTTTGGAAAGGGG - Intronic
935928190 2:108093359-108093381 GCTCCTTTGCTTTTGGAAAGGGG - Intergenic
936245832 2:110826590-110826612 GCTTCTCTGTATGTGGAAACAGG - Intronic
936451245 2:112635449-112635471 GGCCCTCTGTTTGTGGAATGGGG - Intergenic
936511230 2:113149321-113149343 ACTCCTTTGCTTATGGAAAGGGG - Intergenic
936795211 2:116195874-116195896 GCTCCTCGGCTTTTGGCAAGGGG - Intergenic
936885102 2:117300460-117300482 GCTACTCTGCCTTTGGAAAGAGG + Intergenic
936940343 2:117878220-117878242 ACTCCTCTTCTTGTGGAAAGGGG - Intergenic
937591276 2:123615556-123615578 GCTCCTCTGCCTGTGCAAAGGGG + Intergenic
937628386 2:124069245-124069267 ACTCCTCTGACTGTGGAAGGGGG + Intronic
937736474 2:125296878-125296900 GCTCCTCTACCTATGGAAAAGGG - Intergenic
937793923 2:125994657-125994679 ATTCCTCTGCTTCTGGAAAGGGG - Intergenic
938486852 2:131720223-131720245 GCTCCTCAGCTTTTGGAAAGGGG - Intergenic
938587845 2:132708460-132708482 ACTCCTTGGTTTGTGGAAAGGGG + Intronic
939144573 2:138396765-138396787 GTTTCTCTACCTGTGGAAAGGGG + Intergenic
939273644 2:139971379-139971401 GCTCCTCTGCCTGTGGAAAGGGG + Intergenic
939405012 2:141745419-141745441 GCTCCTCTGCCAGTGGAAGGGGG - Intronic
939443148 2:142275668-142275690 GCTCCTGTGCCTTTGGAAAGGGG - Intergenic
939659367 2:144869198-144869220 GCTCATCTGCTTCTGGACATTGG - Intergenic
939707834 2:145477671-145477693 GCTCTGCTGCCTGTGAAAAGGGG - Intergenic
940402288 2:153261799-153261821 ACTCCTCTGCTTGAGGAAAAGGG - Intergenic
940425446 2:153525957-153525979 GCTCCTCTGCCTTTAGAAAAGGG + Intergenic
940503730 2:154527121-154527143 GCTCCTTTGCCTTTGGAAAGGGG - Intergenic
940546935 2:155100605-155100627 GCTGCTCTGCTTGGAAAAAGAGG + Intergenic
940559772 2:155280907-155280929 GATCCTCTGCTTGTGGAAAGGGG - Intergenic
940560394 2:155288061-155288083 GCTCCTCTGTCTTTGGAAAGGGG + Intergenic
940795453 2:158072234-158072256 CCTCCTCTGCCAGTGGAAAAGGG + Intronic
940896581 2:159086964-159086986 GCTACTCTGCTTGTTTAGAGGGG + Intronic
941357547 2:164512038-164512060 GCTCCTCTGCCAGTGAAAAGTGG + Intronic
941528200 2:166632003-166632025 ACTCCTCTGCCTGGGGAAAGGGG - Intergenic
941672523 2:168310343-168310365 GCTCCTCTGCCTGTGGAAAGGGG - Intergenic
941745912 2:169087220-169087242 ACTCCTCTGCTTGTGAAAAGGGG - Intronic
942391736 2:175502359-175502381 GCTCTTCTGCCTGTGGAAAGGGG - Intergenic
942769145 2:179495269-179495291 TCTCCTCTGCTTTTGGAAATAGG + Intronic
942814247 2:180033605-180033627 GCTCCTCTGCCTGTGGAAAGGGG - Intergenic
942834458 2:180277210-180277232 GCTCCTCAGCCTATGGAAAGGGG - Intergenic
942915061 2:181294917-181294939 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
943117456 2:183691477-183691499 GCTCCTCCACCTGTGGAAAGGGG - Intergenic
943208151 2:184927720-184927742 GCTCCTCTGCCTTAGGAAATGGG - Intronic
943226735 2:185187767-185187789 GCTCCTCTGCTTTTGAAAAGTGG - Intergenic
943484667 2:188464747-188464769 GCTCTTCTGCCTTTGGAAAGGGG - Intronic
943845167 2:192635619-192635641 GCTCCTCTGCTTGTGAAAAGGGG + Intergenic
943913170 2:193593790-193593812 GCTCCTCTGCTTGTGGAAAGAGG + Intergenic
943933638 2:193886349-193886371 GCTCCTCTGCCTATGGAAAGTGG + Intergenic
944046227 2:195414491-195414513 ACTCCTCTGCCTGGGGAAAGGGG + Intergenic
944078698 2:195760163-195760185 GCTCCTCTGCCTGTGGAAAGGGG + Intronic
944095884 2:195967953-195967975 GCTCTTCCACTTGTGGAAAGAGG - Intronic
944096757 2:195976330-195976352 TCTCCTCTGCTTATCAAAAGGGG + Intronic
944751942 2:202718022-202718044 GCTCCTCTGCCTATGGAAAAGGG - Intronic
945461616 2:210116193-210116215 ACTGCTCTGCTTGAGGAAAGAGG + Intronic
945575704 2:211525850-211525872 TCTCCCCTTCCTGTGGAAAGGGG + Intronic
946136485 2:217651775-217651797 TCTCCTCTGCATGTGGCAAAAGG - Intronic
946697326 2:222372640-222372662 ACTCCTCTGTCTGTGGAAAAGGG + Intergenic
946984759 2:225258631-225258653 GCTCCATTGCCTTTGGAAAGTGG + Intergenic
947687071 2:232097481-232097503 GCTCCTCTGCCTGTGGAAAGGGG - Intronic
948774724 2:240278121-240278143 ACTCCTCTGCTTGAGGAAAGGGG + Intergenic
1168899867 20:1354492-1354514 ACTCCTCTGCCTGAGGAAAGGGG - Intronic
1169617917 20:7471074-7471096 GCTCCTCAGCCTTTGGAAATGGG - Intergenic
1170086904 20:12544213-12544235 GCTCCTCTGCCTTTGGAGAGGGG - Intergenic
1170236088 20:14106304-14106326 TCTCCTCTGCCTTTGGAAAGGGG + Intronic
1170668452 20:18406961-18406983 GTTCCTCTGCCTGTGGAAAGGGG + Intronic
1171938026 20:31294227-31294249 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
1173004101 20:39126644-39126666 GCTCTTCTGCCTTTGGAAAGGGG - Intergenic
1173204166 20:40979678-40979700 GCCCCTCTGCTTATGGAAGTGGG - Intergenic
1174721274 20:52815411-52815433 GCTCCCTTGCTTGTACAAAGGGG - Intergenic
1175168430 20:57062841-57062863 GCTCATCTGCTCGTGGAACCTGG + Intergenic
1175632124 20:60550156-60550178 ACTTCTCAACTTGTGGAAAGAGG - Intergenic
1176737218 21:10561640-10561662 GCTCCTCTGCCTTTGGACAGGGG + Intronic
1176876678 21:14136472-14136494 GCTCCCCTGTCTTTGGAAAGGGG + Intronic
1176899384 21:14420717-14420739 ACTCCTCTGCCTTTGGAAAGGGG + Intergenic
1176939879 21:14911579-14911601 ACTCCTCTGCATGAGGAAAGGGG - Intergenic
1176995004 21:15544637-15544659 GCTCCTCTGCTTGTGGAAAGGGG + Intergenic
1177212894 21:18091856-18091878 GCTCCTCTGCCTGTGGAAAGGGG + Intronic
1177456371 21:21344532-21344554 GCTCCTCTGCCTTTGGAAATGGG + Intronic
1177487948 21:21783273-21783295 ACTCCTCTGCCTGTGGAAAGGGG - Intergenic
1177761429 21:25406699-25406721 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1177849885 21:26333490-26333512 ACTCCTCTGCTTGTGGAAGGGGG + Intergenic
1179233383 21:39525284-39525306 GCTCCTCTGCCTGTTGAAACGGG - Intergenic
1179327860 21:40367206-40367228 TCTCCTCTGCTTTTGGAGATGGG + Intronic
1179395972 21:41040246-41040268 GCTCCTCTGCCTTTAGAAAAAGG + Intergenic
1179652553 21:42821014-42821036 GCTCCTCTGCTTACGGAAGTGGG + Intergenic
1180491057 22:15849125-15849147 GCTCCTCAGCTTTTGGAAAGGGG - Intergenic
1180563219 22:16639191-16639213 GCTCCTCTGCCTTTGGACAGGGG + Intergenic
1180797239 22:18611813-18611835 GCTCCTGTACTTGGAGAAAGGGG + Exonic
1180944955 22:19687732-19687754 GCTCCTCACGTTGTGCAAAGGGG + Intergenic
1181224484 22:21383458-21383480 GCTCCTGTACTTGGAGAAAGGGG - Exonic
1181254148 22:21551355-21551377 GCTCCTGTACTTGGAGAAAGGGG + Exonic
1181784868 22:25219714-25219736 GCTCCCATGCTTGCGGACAGGGG - Intronic
1183497260 22:38154000-38154022 ACTTCTCTGCTTGTGGAAAGGGG + Intronic
1183531907 22:38360953-38360975 GCTCCTCTGTCTTTGGACAGGGG - Intronic
1184041352 22:41946069-41946091 GCTGCCCTTCATGTGGAAAGAGG + Intronic
1184857128 22:47152411-47152433 CCTCCTCTGCTTGTGGCTGGCGG + Intronic
1184961756 22:47934240-47934262 GCTCCTCTGGTGGGGGAAGGTGG - Intergenic
949235642 3:1805815-1805837 GTTCCTCTGCCTTTAGAAAGGGG - Intergenic
950064013 3:10096740-10096762 GCTCCTCTAGCTGTGGAGAGAGG - Intronic
950695584 3:14699012-14699034 ACTCCTCTGCCTGTGGAAGAGGG - Intronic
951032183 3:17895148-17895170 GCTCCTTTGCCTATGGAAAGGGG - Intronic
951102367 3:18703656-18703678 GCTCCTCTGCCTTTGGAAAGTGG + Intergenic
951310231 3:21116756-21116778 GCTCCTCTGCCTCTGGAAAGGGG - Intergenic
951379791 3:21969120-21969142 ACTCCTCTGCTTGTAAAATGGGG + Intronic
951435409 3:22657125-22657147 GCTCCTCTTCCTTTGGAAAGGGG - Intergenic
951494857 3:23315193-23315215 ACTCCTCTGCCTGGGGAAAGGGG - Intronic
951494993 3:23316353-23316375 ACTCCTCTGCCTGGGGTAAGGGG - Intronic
951904353 3:27689047-27689069 GCTCCTTTGCCTTTGGAAAAGGG + Intergenic
952066392 3:29576718-29576740 GCTCCTCTGCCTGTGGAAAGGGG - Intronic
952139773 3:30465858-30465880 TCTCCTTTGCCTTTGGAAAGGGG - Intergenic
952203083 3:31151377-31151399 GCTCCTCTGTCTTTGGAAAGGGG - Intergenic
952222014 3:31332504-31332526 GCTCCTTTGCCTTTGGAAATTGG + Intergenic
952389390 3:32866710-32866732 GCTCCCCTGCTTGTGGGACCAGG - Intronic
952517846 3:34124071-34124093 ACTCTTCTGCTTATGGAAAGAGG - Intergenic
952912663 3:38204075-38204097 ACTCCTCTACTTGTGGAAAGGGG - Intronic
952972597 3:38662067-38662089 GCTCGGCAGCTTGGGGAAAGGGG - Intergenic
953217277 3:40931088-40931110 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
953229321 3:41050595-41050617 GCTCCTTTGACTGTGGAAATGGG - Intergenic
953309470 3:41863192-41863214 GATCCTCTCCCTTTGGAAAGGGG - Intronic
954487979 3:50872779-50872801 GCTCCTCTGCCTTCGGAAAGGGG - Intronic
955084833 3:55692633-55692655 GCTCTTTTGCCTGTAGAAAGAGG + Intronic
955441148 3:58956437-58956459 ACACCTCTGCCTTTGGAAAGGGG + Intronic
955632925 3:60994265-60994287 GATTCTCTCCTTGTGGAAATGGG + Intronic
956223032 3:66923953-66923975 GTTCCTCTGCCCGTGGAAAGGGG + Intergenic
956292155 3:67672399-67672421 GCACCTTTGCTTCTGGGAAGGGG + Intergenic
956476176 3:69622151-69622173 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
956902335 3:73729885-73729907 CTTTCTCTGCTTGTGGAGAGTGG + Intergenic
956939157 3:74136698-74136720 GTTCCTCTGCCTGGGGGAAGTGG - Intergenic
957907584 3:86578056-86578078 GCTTCTCTGCCTGTGAAAAGAGG - Intergenic
957925497 3:86805432-86805454 GCTCCTCCGCCTATGGAAAGAGG + Intergenic
958099440 3:88989588-88989610 ACTCCTCTGCATGTGGAAAAGGG + Intergenic
958617670 3:96515685-96515707 GCTCCTCTGCCTGTGAAAAGGGG + Intergenic
958631153 3:96685540-96685562 GCTCCTCTGCCTTTGGAAAAAGG - Intergenic
958632232 3:96699528-96699550 GCTTCTCTGCCTATGGAAAGAGG - Intergenic
958669082 3:97180131-97180153 GCTCCTCTGCCTTTGAAAAGGGG - Intronic
958756841 3:98259884-98259906 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
958765272 3:98360425-98360447 GCTCCTCTGCCTTTAAAAAGGGG - Intergenic
958840032 3:99192162-99192184 GCTCATCTGCCTGTGGAAAGCGG + Intergenic
958876738 3:99625107-99625129 GCTCCTCTGCCTTTAGAAAGGGG + Intergenic
959118450 3:102205821-102205843 GATTCTCTGTTTGTAGAAAGAGG - Intronic
959125394 3:102284358-102284380 ACTCCTCTGCTTGTGGAAAGTGG - Intronic
959189815 3:103097209-103097231 GCTCCATTGCCTGTGGAAAGGGG - Intergenic
959303962 3:104636109-104636131 TCTCCTCTGCCTTTGGAAAGGGG + Intergenic
959336135 3:105067059-105067081 GCTCCTCTGCCTGTGGAAAGAGG + Intergenic
959547389 3:107612985-107613007 ACTCCTCTGCCTGGGGAAAGGGG - Intronic
959724968 3:109532977-109532999 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
959798076 3:110456880-110456902 GCTTCTCTGTCTTTGGAAAGGGG - Intergenic
959806558 3:110561818-110561840 ACTCCTCTACTTGTGTAAAGAGG - Intergenic
959913669 3:111793273-111793295 TCTCCCCTGCTTGAGGAAAGGGG - Intronic
960067376 3:113387950-113387972 ACTTCTCTGCTTGTGGAAAAGGG + Intronic
960153478 3:114274737-114274759 ACTCCTCTGCTTGCAGAAAGGGG - Intergenic
960298017 3:115967933-115967955 ACTCCTCTGCTTGGGAAAAAGGG - Intronic
960541136 3:118864105-118864127 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
960564971 3:119123252-119123274 GTTCCTTTGCCTGTGTAAAGAGG + Intronic
960681329 3:120250121-120250143 GTTCCTCTGCCTTTGGAAAGGGG + Intronic
961090097 3:124103473-124103495 GCTCTTCACCTTGTGGACAGAGG + Intronic
961964375 3:130887569-130887591 GCTCCTCTGCCTGTGGAAAGGGG - Intronic
962038726 3:131682876-131682898 GCTACTCTGCTTGTGGAAAGGGG - Intronic
962193636 3:133336954-133336976 GCTTCTCTCCCTGTGGAAAGGGG + Intronic
962319452 3:134378448-134378470 GATCCTCTGCTCTTGGCAAGAGG + Intergenic
962483380 3:135816883-135816905 GTTCCTCTTCCTGTGGTAAGGGG + Intergenic
962759069 3:138492426-138492448 GCCCCTCTGCCAGAGGAAAGGGG - Intergenic
962767639 3:138580113-138580135 CCTTCTCTGCCTGGGGAAAGGGG + Intronic
963020415 3:140868398-140868420 AATCCTCTGCTTATGGAAAGGGG - Intergenic
963154179 3:142078082-142078104 ACTCCTCTGCCTGTGGAAAGGGG + Intronic
963310143 3:143700570-143700592 GTCCCTCTGCCTGTGGAAAGGGG + Intronic
963448101 3:145440406-145440428 GTTTCTCTGCCTTTGGAAAGGGG + Intergenic
963591842 3:147270138-147270160 GCTCCTCTCCCTTTCGAAAGGGG + Intergenic
963692318 3:148519642-148519664 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
963763300 3:149307584-149307606 GCTCCTCTGCCTGTAGAAAGAGG - Intergenic
964059545 3:152505094-152505116 GATCCTCTGCCTTCGGAAAGGGG - Intergenic
964239544 3:154575030-154575052 TCTCCTCTGCCTTTGGAAAAAGG + Intergenic
964253752 3:154750511-154750533 ACTCCTCTGTCTGGGGAAAGAGG + Intergenic
964318176 3:155465887-155465909 GCTCCTCTGCCTTTGGAAAAAGG + Intronic
964339040 3:155688801-155688823 GCTCCTCTGCCTGTGGAAAGGGG + Intronic
964349868 3:155791733-155791755 ACTCTTCTGCTTGTGGAAAGGGG + Intronic
964379092 3:156079309-156079331 ACTCCTCTGCTTCTGGAAAGGGG - Intronic
964398384 3:156272448-156272470 ACTCGTCTGCCTGGGGAAAGGGG - Intronic
964810150 3:160654513-160654535 GCTCCTCTTTCTGTGGAAAGGGG + Intergenic
964952727 3:162316810-162316832 GCTCCTCTGCCTTTAGAAAGTGG - Intergenic
964965012 3:162481660-162481682 CCTCCTCAGCTTTTGGAAACAGG - Intergenic
965026223 3:163304402-163304424 GTTCCTCTGTCTGTAGAAAGGGG + Intergenic
965079236 3:164017728-164017750 CCTCCTCTGCTTTTGTCAAGAGG - Intergenic
965236831 3:166135928-166135950 GATCATCTGCCTGTGGAAAGGGG - Intergenic
965250879 3:166342612-166342634 TCTCCTCTGCCTTTGTAAAGAGG + Intergenic
965349917 3:167599324-167599346 GCTCCTCTGCCTGTGAAAATGGG - Intronic
965350964 3:167610444-167610466 GCTTCTCTGCCTTTGGAAAAAGG + Intronic
965513474 3:169594614-169594636 CCTCCTCTGCTTGGGGAAATGGG + Intronic
966141999 3:176767355-176767377 ACCCCTCTGCTTGTGGAAAGAGG + Intergenic
966312988 3:178615512-178615534 GCTCCTTTGCCTTTGGAAAGGGG - Intronic
966452116 3:180074324-180074346 GTTCCTCTGCCTTTGGAAAGGGG + Intergenic
966678660 3:182617122-182617144 ACTCCTGTGCTTGAGAAAAGAGG - Intergenic
967534492 3:190586753-190586775 ACTCCTCTGCTTTTTAAAAGTGG + Intronic
967609327 3:191484397-191484419 ACTCCTCTGCTTGTGGAAAGCGG + Intergenic
967655590 3:192044238-192044260 ATTCCTCTGCCTGTGGAAAAAGG + Intergenic
968429091 4:544787-544809 GCTCCCCTGCTTTTGGAAAGGGG - Intergenic
969893584 4:10281924-10281946 TCTCCTGTGCTGGTGGAATGTGG + Intergenic
969894415 4:10289948-10289970 GCTGCTCTCCTGGTGGACAGGGG + Intergenic
970071167 4:12161785-12161807 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
970097924 4:12486402-12486424 ACTCCTCTGCTTGAGGAAAGGGG - Intergenic
970963396 4:21898984-21899006 GCACCTCTGCATGTGGAAAGGGG + Intronic
971095615 4:23399074-23399096 ACTCCTCTGCCTGTGGAAAGGGG - Intergenic
971567781 4:28167811-28167833 GCTCCTATGCCTTTGGAAAGAGG - Intergenic
971701655 4:29984852-29984874 GCTCCTCTGCCTTTAAAAAGGGG + Intergenic
971914462 4:32850585-32850607 GCTCCTCTGACTGTGGAAAGGGG - Intergenic
972856575 4:43114320-43114342 TCTCCTCTGCCTTTGGAAAGGGG + Intergenic
972902323 4:43700315-43700337 GCTCCTCTGCCTTTGGAAAGAGG - Intergenic
973053970 4:45630871-45630893 GTTCTTCTGCCTATGGAAAGGGG + Intergenic
973327388 4:48877554-48877576 GGTCCTCTCCCTGTGGAAATGGG - Intergenic
973542006 4:51944366-51944388 GCTCTTCTGTTACTGGAAAGTGG - Intergenic
973757558 4:54090876-54090898 GCCCCTCTGCTTGAGGACAGAGG + Intronic
973845120 4:54903982-54904004 ACTCCTCAACTTGTGGAAATTGG - Intergenic
974301072 4:60067664-60067686 GTGCCTCTGCTTGTGGAAAGGGG + Intergenic
974333201 4:60506002-60506024 GTTCCTCTGCCTGTGGTTAGGGG + Intergenic
974337547 4:60569827-60569849 GCTTCTCCTCTTTTGGAAAGGGG - Intergenic
974352957 4:60773554-60773576 GCTTTTCTGCCTGTGGAAAGGGG - Intergenic
974593209 4:63983075-63983097 GCTCCTCAGCCTTTAGAAAGGGG - Intergenic
974597182 4:64029789-64029811 GCTTCTCTGCCTTTGGAAAGGGG - Intergenic
974630291 4:64479884-64479906 GCTCCTCTGCCCTTGGAAAGGGG - Intergenic
974770322 4:66403570-66403592 ACTCCTCTGCTTGGGAAAAGGGG - Intergenic
974780195 4:66544119-66544141 GCTCCTCTGCCTTTGAAAAGGGG + Intergenic
974893200 4:67907054-67907076 TCTCCTCTGCCTTTGGAAAAGGG - Intergenic
975081044 4:70280899-70280921 GCTCCTGTGCCTATGGAAAGAGG + Intergenic
975095271 4:70450191-70450213 GCTCCTCTGCCTTGGGAAAAGGG - Intronic
975369445 4:73567987-73568009 ATTCCTTTGCCTGTGGAAAGGGG - Intergenic
975375903 4:73645720-73645742 GCTCCTTGGCCTGTGGCAAGTGG - Intergenic
975502218 4:75099760-75099782 GCTCCTCTGCCTTTGTAAAGTGG - Intergenic
975503955 4:75117651-75117673 GCTCCTCTGCCTTTGAAAAGGGG + Intergenic
975592724 4:76016813-76016835 GCTCCTCTGCCTCTGGAAAGGGG - Intronic
975629831 4:76388493-76388515 GCTCCTCTGCCTTTGGAAAGGGG + Intronic
976041150 4:80886110-80886132 GCTCCTCTGCCTGTGGAAATGGG + Intronic
976451809 4:85199369-85199391 GCTTCTCTGCCTTTGGAAAGGGG - Intergenic
976982120 4:91244169-91244191 GCTCCTATGCCTGTGGAAAGGGG + Intronic
977044455 4:92051473-92051495 GGTCCTCTTCCTTTGGAAAGGGG + Intergenic
977397014 4:96484014-96484036 GTTCCTCTGTCTGTGGAAAGAGG - Intergenic
977399339 4:96511391-96511413 GCTCCTATGCCTTTGGAAAGGGG + Intergenic
977521894 4:98094760-98094782 GCTCCTCTGCCTGTGGAAAGGGG + Intronic
977873635 4:102123639-102123661 ACTCCTCTCCTTGTGGAAAGGGG - Intergenic
978030975 4:103939466-103939488 GCTTCTCTGCCTTTGGAAAGAGG + Intergenic
978112468 4:104978962-104978984 GCTCTTCTGCCTGTGAAAAGGGG + Intergenic
978287864 4:107099367-107099389 TCTGCTCTGCCTGTGGAAAGGGG + Intronic
978520463 4:109610013-109610035 GCTCCTCTGCTTGTGGAAAGGGG - Intronic
978577655 4:110202454-110202476 CCTCCTCTGCTTTTGTCAAGAGG - Intergenic
979142964 4:117201565-117201587 GCTCCTCTGCCTGTGGAAAATGG + Intergenic
979213229 4:118132304-118132326 GCTCTTCTCCCTGTGGAAAGGGG - Intronic
979395091 4:120178156-120178178 ATTCCTCTGTTTGTGGAAAGGGG + Intergenic
979573048 4:122252557-122252579 GATTCTCTGCCTGTGGAAAGGGG + Intronic
979600933 4:122585991-122586013 GCTCTTCTGCTTCTGGAACTTGG - Intergenic
980172348 4:129305492-129305514 GCTCCTCTGCCTGTGGAAAGGGG - Intergenic
980347265 4:131636730-131636752 ACTCCTCTGCCTATGAAAAGGGG + Intergenic
980443009 4:132871593-132871615 GCTCCCCTGCCTTTGGAAAGGGG + Intergenic
980660762 4:135855229-135855251 GCTCCTCTGCCTCTGGAAAGAGG - Intergenic
980682963 4:136187602-136187624 ACTCCTTTGCTTGAGGAAAGGGG + Intergenic
980686889 4:136240591-136240613 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
980693065 4:136320702-136320724 GCCTCTCTGCTTGTGGAAAGGGG + Intergenic
980723487 4:136727526-136727548 GCTCCTCTGCCTTTGGAAAATGG - Intergenic
980821552 4:138023398-138023420 GCTCATCTGCTTCTGGAGCGTGG + Intergenic
980960503 4:139470290-139470312 GCTCCTCTGTCTTTGGAAATGGG - Intronic
981329262 4:143488954-143488976 CCTCCTCTGTCTTTGGAAAGGGG + Intergenic
981518296 4:145634301-145634323 GCTCCTCTGCCTTTGGAAAAGGG - Intronic
981558554 4:146022795-146022817 GCTCCTCTGCCTGTGGAAAGTGG - Intergenic
981870995 4:149486379-149486401 GATCCTCTGCCTGTGGAAACTGG - Intergenic
981895702 4:149796317-149796339 GCTCCTCTCCCTTCGGAAAGGGG + Intergenic
982615352 4:157634025-157634047 GCTCCTCTGCCAATGGAAACAGG + Intergenic
982683322 4:158458907-158458929 TCTCCTCTGTCTTTGGAAAGTGG - Intronic
982726402 4:158910815-158910837 GCTCCTGTGATTGTGGAAGTTGG - Intronic
982899476 4:160980553-160980575 GTGCCTCTTCCTGTGGAAAGGGG - Intergenic
983017287 4:162628756-162628778 ACTCTTCTGCCTGTGGAAAGAGG + Intergenic
983165909 4:164477302-164477324 GCTCCTCTGTCTGTGGAAAAAGG - Intergenic
983338021 4:166420983-166421005 ACTCCTCTGCTTGTGGAAAGGGG - Intergenic
983931832 4:173460975-173460997 TGTCCTCTGCTTTTAGAAAGGGG + Intergenic
984129557 4:175856816-175856838 GCTCCTCTGCCAGTGGAACTTGG + Intronic
986334190 5:6741002-6741024 GCTCCTCTGTGTGTGCCAAGGGG + Intronic
986492777 5:8308829-8308851 GCTCCTCTGACTTTGGAAATGGG + Intergenic
986544393 5:8879846-8879868 GCTCCTCTGCCTCTGGAAGGGGG - Intergenic
986657522 5:10030318-10030340 GCTCCTCTGCTTTTGGAAAGAGG - Intergenic
986756373 5:10840126-10840148 GCTCCTCTGCCTTTGGAAAGTGG + Intergenic
986758021 5:10855853-10855875 GCTGCTCTCCTTGTGCAAATGGG + Intergenic
986913407 5:12585763-12585785 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
987164018 5:15174600-15174622 GCTCCTCTTCCTGTGGAAATGGG + Intergenic
987457951 5:18170040-18170062 ACTCCTCTGATTGTGGAAAGGGG + Intergenic
987496526 5:18652553-18652575 GCTCTTTTGCCTGTGGAAAGGGG - Intergenic
987616164 5:20276922-20276944 ACTCCTCTGCTTGTGGAAAGGGG + Intronic
987773064 5:22331058-22331080 GCTCCTCTGCCTGTGGAAAGGGG + Intronic
987823159 5:22991769-22991791 GTTCCTCTGTCTTTGGAAAGAGG + Intergenic
987953079 5:24701726-24701748 GCTCTTCTGCCTGTGAAAAGGGG - Intergenic
988117898 5:26920271-26920293 ACTCTTCTGCTTGAGGAAAGGGG + Intronic
988340172 5:29960533-29960555 GCTCCTCTGCCTGTGGAAAGGGG + Intergenic
988939397 5:36127673-36127695 ACTCCTCTGCTTGTGAAAAGGGG + Intronic
989504784 5:42215240-42215262 GTTCCTCTGCCTTTGGAAAGTGG - Intergenic
989629021 5:43461692-43461714 GCTCCTCTGTCTTTGAAAAGGGG + Intronic
989970701 5:50521136-50521158 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
990827984 5:59923113-59923135 TCTCCTCTGCTTTTAGAAAAGGG + Intronic
990933065 5:61115150-61115172 ACTCCTTAGCTTGTGGAAAGGGG - Intronic
991018609 5:61957834-61957856 GCTCCTCTGCCTTTGGAAAGAGG - Intergenic
991087432 5:62660886-62660908 GTTCATCTGCTTGTGGAGCGTGG - Intergenic
991107411 5:62860671-62860693 GCTACTCTGCCAGTGGAAAAGGG - Intergenic
991180542 5:63746514-63746536 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
991205303 5:64042678-64042700 GCTCCTCTGCCTTTGGAAAAAGG + Intergenic
991237811 5:64419294-64419316 GTTCCTCTACCTGTGGAAAGGGG + Intergenic
991663686 5:68974838-68974860 GCTCCTCTGACTTTGGAAAGGGG + Intergenic
991693725 5:69250414-69250436 ACTCCTCTGCCTGAAGAAAGGGG - Intronic
992345244 5:75869411-75869433 GCTCATCTGCCTTTGGAAAGGGG + Intergenic
992531729 5:77659050-77659072 ACTCCCCTGCTTGTGGAAAGAGG - Intergenic
992587212 5:78252625-78252647 GCTCCTCTGCCTTCAGAAAGGGG + Intronic
992778943 5:80110818-80110840 GATCCTCTGCCTTTGGCAAGAGG - Intergenic
992804303 5:80322221-80322243 GCTCCTCTGCTAGTGAACTGTGG + Intergenic
992992512 5:82298609-82298631 GCTCATCTGCTTGTGGAGCCTGG + Intronic
993155656 5:84218819-84218841 AGTCCACTGGTTGTGGAAAGGGG + Intronic
993287301 5:86016096-86016118 GCTCCTCTTCCTGTGGAAAGGGG - Intergenic
993580479 5:89653980-89654002 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
993981313 5:94546122-94546144 GCTCCTCTGCCTGTGGAAAGGGG + Intronic
994028617 5:95114558-95114580 GCTCCTCTGCCTGTGGAAAGGGG + Intronic
994217803 5:97158851-97158873 ACTCCTTTGCTTGTGGAAAAGGG - Intronic
994235559 5:97358344-97358366 GCTTCTCTGACTTTGGAAAGGGG - Intergenic
994310026 5:98259045-98259067 ACTCCTCTGCTTGAGGAAAGGGG - Intergenic
994477574 5:100290453-100290475 GCTCCTCTGCCTTTGGAAAGAGG - Intergenic
994530013 5:100957102-100957124 GCTCCTCTGCTTTTGGAAAGGGG + Intergenic
994563169 5:101403626-101403648 GCCCCTCTTTTTGAGGAAAGGGG - Intergenic
994612865 5:102067222-102067244 GCTGCTCTGTTTCTGGAAAAAGG - Intergenic
994616124 5:102107035-102107057 GCTCTTCTGCCTTTGTAAAGAGG - Intergenic
994627827 5:102243107-102243129 GCTTCTCTGCCTTTGCAAAGGGG + Intronic
994633888 5:102320450-102320472 GCTCCTTTGCCTTTGGAAAAAGG - Intergenic
994819273 5:104627977-104627999 GCTCATCTGCTTGTGGAGCCTGG - Intergenic
994853872 5:105091376-105091398 GCTCCTCTGCCTTTGGAAAGAGG + Intergenic
995096415 5:108240464-108240486 ACTCCTCTTCTTATGGAAAGGGG + Intronic
995278525 5:110307016-110307038 GCTCCTCTGCCATTAGAAAGGGG - Intronic
995557592 5:113345165-113345187 GCTCCTCTGCCTATGGAAAGGGG + Intronic
995573102 5:113502604-113502626 ACTCCTCTGCTTGAGGAAAGGGG - Intergenic
996116355 5:119624374-119624396 GCTCCTCTTCCTTTGGAAAGGGG - Intronic
996259361 5:121446470-121446492 GCTCCTCTGCCTGCAAAAAGGGG + Intergenic
996459592 5:123725771-123725793 GCTCCCCTGCTTGTGGAAAAGGG + Intergenic
996666617 5:126066985-126067007 GCTCCTCTGCCTGTGGAAAGAGG + Intergenic
996931603 5:128896006-128896028 GCTCCTTTGCCTGTAGAAAGAGG - Intronic
996968339 5:129331862-129331884 GCTCCTCTGCATTTGGAAAGGGG + Intergenic
997104759 5:131005956-131005978 ATTCCTCTGGTTATGGAAAGGGG + Intergenic
997436895 5:133881987-133882009 GCTCACCTGCTTGTGGACCGTGG + Intergenic
997664718 5:135620625-135620647 ACTCCTCTGCTTGGGGAGTGGGG + Intergenic
998291143 5:140916032-140916054 GCACCTCTGCCTGTGGAAAGGGG - Intronic
998695262 5:144631051-144631073 GATCCTTTGCCTTTGGAAAGGGG + Intergenic
999002475 5:147939493-147939515 GCTCCTTTGCCTTTGGAAAGGGG - Intergenic
999345697 5:150817180-150817202 GCTCCTCTTCCTTTGGAAAGGGG + Intergenic
999719018 5:154385024-154385046 GCTCATCTGCTACTGGAAGGAGG + Intronic
999919462 5:156303216-156303238 ACTCCTCTGCTTATGGAAAAGGG - Intronic
1000159805 5:158586593-158586615 GCTCCTCTACCTTTGGAAAGGGG - Intergenic
1000234469 5:159344720-159344742 GCTCCTCTGCCAGTGGAACTTGG + Intergenic
1000270277 5:159677438-159677460 ACTTCTCTGCCTTTGGAAAGAGG + Intergenic
1000651273 5:163821873-163821895 GCTCCTCAGCCTTTGGAAAGGGG - Intergenic
1001177711 5:169487170-169487192 GCTCCTCAGGCTTTGGAAAGGGG + Intergenic
1003383487 6:5646493-5646515 GCTCCTCTACTCTTGAAAAGAGG + Intronic
1003590536 6:7433103-7433125 GCTGCTCAGCGTGTGGAAACGGG + Intergenic
1004620581 6:17327069-17327091 CCTCCTCTGCTTTTGTCAAGAGG - Intergenic
1005037353 6:21569293-21569315 ACTCCTTTGCTTGAGGAAAGGGG - Intergenic
1005157006 6:22818973-22818995 GATCTTCTGCCTATGGAAAGGGG - Intergenic
1005290602 6:24375198-24375220 GCTCCCCTCCCTGTGGAATGAGG + Intergenic
1006018526 6:31102786-31102808 GCTCCTCTGCCTAAGGAAAGGGG - Intergenic
1006342729 6:33455449-33455471 GCTCATCTCCTTGTGGCCAGTGG + Exonic
1006403028 6:33828836-33828858 TCTCTGCTGCTTGTTGAAAGAGG + Intergenic
1006462889 6:34173765-34173787 GCTCCTGTGCCTGCGGAAAGGGG - Intergenic
1006963780 6:37961258-37961280 GCTCCTCTGCCTTTGGAAAGGGG + Intronic
1007229095 6:40335808-40335830 ACTCCTCTGCATGTGCACAGTGG + Intergenic
1008017912 6:46541912-46541934 GCTCCTCTACCTTTGGAAAAGGG + Intergenic
1008192416 6:48475892-48475914 ACTCCTCTGCTTGGAGAAAAGGG + Intergenic
1008215092 6:48778567-48778589 GTTCCTCTGCTTTTAGAAAGGGG + Intergenic
1008250305 6:49231816-49231838 GCTCCTATGCCTCTGGAAATGGG - Intergenic
1008304548 6:49885896-49885918 ACTCCTCTGCTTGAGGTAAGAGG - Intergenic
1008314751 6:50026143-50026165 GCTCCTCTGACTGTTGAAAGGGG + Intergenic
1008641974 6:53473773-53473795 ACTGCTCTGGTTGTGGAAAAGGG - Intergenic
1008707499 6:54181247-54181269 GCTCTTTTGCCTGTGGAAAGGGG - Intronic
1008822488 6:55650778-55650800 GCTCCTCTGCCTATGGAAATGGG - Intergenic
1008940573 6:57041246-57041268 GCTCCTCTGCCTGGGTAAAAGGG + Intergenic
1009039297 6:58158062-58158084 ACTCCTCTGCTTTTGGGAAAGGG - Intergenic
1009215196 6:60912905-60912927 ACTCCTCTGCTTTTGGGAAAGGG - Intergenic
1009353103 6:62707311-62707333 GCTCCTTTGCCTTTAGAAAGGGG - Intergenic
1009353367 6:62709182-62709204 GCTCCCCTGCCTGTGGAAATGGG - Intergenic
1009371221 6:62905632-62905654 GCTCCTCTGCCTATAGAAAAGGG + Intergenic
1009388076 6:63111261-63111283 GCTCCTCTGCTTGTGGAAAGGGG - Intergenic
1009687751 6:66986233-66986255 GTTCCTCTGCCTTTGGGAAGGGG - Intergenic
1009771181 6:68144819-68144841 GCTCCTCTGCCTTTGGAATGGGG - Intergenic
1009823839 6:68840576-68840598 ACTCCTCTGCTTTTGGAAATGGG + Intronic
1009893838 6:69721964-69721986 ACTCCTCTGCCTGTGGAAAGGGG + Intronic
1010050735 6:71501156-71501178 GTTCCTCTGCTTGTGGTCATTGG - Intergenic
1010063873 6:71657127-71657149 GCTCCTCAGGTTGTGTAAATCGG + Intergenic
1010264699 6:73853010-73853032 ACTCCTATGCCTGTGGAAAGGGG - Intergenic
1010324538 6:74549898-74549920 GCTTCTCTGCCATTGGAAAGGGG - Intergenic
1010325113 6:74555131-74555153 GCTCCTCTACCTTTGGAAAGGGG + Intergenic
1010474842 6:76274657-76274679 GCTACGCTGCCTGAGGAAAGGGG - Intergenic
1010502250 6:76615314-76615336 GCTACTCTGCCTGTGGAAAGGGG + Intergenic
1010528946 6:76942504-76942526 ACTCCTCTGCCTTTGGAAAGGGG + Intergenic
1010644807 6:78373785-78373807 GCTCCTCTGCTTGTGGAAAGAGG + Intergenic
1010676714 6:78753946-78753968 GCTCCTCTGCCTGTGGAAAGGGG + Intergenic
1010772615 6:79848499-79848521 GCTCCTCTACTTATGGAAAGGGG + Intergenic
1010775404 6:79879173-79879195 GCTCCTCTGCCTATGGAAAGGGG + Intergenic
1011033253 6:82944868-82944890 GCTCTTCTGCCTGTGGAAAGGGG + Intronic
1011102877 6:83743848-83743870 GCTCCTCAGCCTGTGGAAAGAGG - Intergenic
1011322786 6:86115680-86115702 GCTCCTCTGCCTGTGGAAAGGGG - Intergenic
1011359678 6:86510567-86510589 ACTCCTTTGTTTGAGGAAAGGGG - Intergenic
1011901390 6:92302453-92302475 GTTCCTCTGCTTTTGGAAAGGGG + Intergenic
1012003670 6:93685351-93685373 GCTCCTCTGCCTATGGAAAGGGG + Intergenic
1012073714 6:94657252-94657274 GCTCTTCTGCCTGTGGAAAGAGG - Intergenic
1012189532 6:96262173-96262195 ACTCCTTTGCTTTTGGAAAGAGG + Intergenic
1012224549 6:96689049-96689071 GCTCCTCTGCCTGTGGAAAGGGG + Intergenic
1012288046 6:97417335-97417357 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1012288355 6:97421501-97421523 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1012486190 6:99724956-99724978 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1012620505 6:101339142-101339164 GCTCCTCTGCCTTTTGAAAGGGG - Intergenic
1012715302 6:102661092-102661114 ACTCCTCTGCCTGTGAAAAGAGG + Intergenic
1012717742 6:102698683-102698705 ACACTTCTGCTTGTGGAAAGGGG - Intergenic
1012761673 6:103310152-103310174 GCTCTTCTGCCTTTGGAAAGGGG + Intergenic
1012807042 6:103908114-103908136 GCTCCTTTGCATATGGAAAGGGG - Intergenic
1012824068 6:104125754-104125776 ACTCATCTGCTTGCGGAATGAGG - Intergenic
1012892167 6:104908621-104908643 ACTTCTCTGCTTGTGGAAAGGGG + Intergenic
1012945437 6:105460995-105461017 GCTCTTCTGCTTGTGGAGCCTGG - Intergenic
1013578658 6:111510438-111510460 GCTCCTCTGCCTGTGGGACCTGG + Intergenic
1013687507 6:112601937-112601959 GCTCCTCTGCCTGTGGAAAGAGG + Intergenic
1013908603 6:115246986-115247008 ACTCCTCTACTTGTGGAAAGGGG + Intergenic
1013925574 6:115468031-115468053 GCTCCTCCGCCTTTGGAAAGAGG - Intergenic
1014073877 6:117215097-117215119 ATTCCTCTGCTTGAGGAAAGTGG - Intergenic
1014840749 6:126217989-126218011 ACTCCTCTGCTTGTGAAAAGGGG - Intergenic
1014865196 6:126520998-126521020 GCTCCTCTGCCTTTGGAAAGTGG - Intergenic
1015030365 6:128587035-128587057 GCTCCTCTACCTTTGGAAAGGGG + Intergenic
1015959496 6:138632126-138632148 GCTCCTCTGCCTTGGGAAAGGGG + Intronic
1016061528 6:139636159-139636181 GCTCCTCTACCTGTGGAAAGGGG - Intergenic
1016135266 6:140532815-140532837 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
1016136834 6:140554655-140554677 GATCCTCTGCCTGTGAAAAGGGG - Intergenic
1016151259 6:140745528-140745550 GCTCCTCTGCCTTTGAAAACGGG + Intergenic
1016185674 6:141195628-141195650 GCTCCTCTGACTTTGAAAAGGGG - Intergenic
1016231028 6:141804106-141804128 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1016241102 6:141931906-141931928 GCTCCCCACCTTGTGGAGAGGGG + Intergenic
1016567533 6:145472669-145472691 GCTCCCCTGCCTTTGAAAAGGGG + Intergenic
1017315568 6:153027468-153027490 GCTCCTCGGCTTCTAGACAGAGG - Intronic
1017379703 6:153813985-153814007 GCTCCTCTGCCTTTGAAAAGGGG + Intergenic
1017387434 6:153901942-153901964 GCTGCTCTTCCTGTGGAAAGGGG + Intergenic
1018316617 6:162562602-162562624 GCTCCTCTGCCTTTGGAAAGGGG + Intronic
1018535885 6:164818523-164818545 GCTCTTCTGCCTTTGGCAAGGGG + Intergenic
1019262920 7:92142-92164 CCTCCTCTGAGTGTGGAGAGGGG - Intergenic
1019765041 7:2843928-2843950 GCGCATCTGCTTGAGGAACGTGG + Exonic
1020519929 7:9173086-9173108 ACTCTTCTGCCTTTGGAAAGGGG - Intergenic
1020607330 7:10355977-10355999 GCTCCTCTGCCTGTAGAAAGGGG - Intergenic
1020812709 7:12865181-12865203 GCTTCTCTGCCTGTGGAAAGGGG + Intergenic
1021214545 7:17900552-17900574 ACTCCTCTACTTGTGGAAAGGGG - Intronic
1021353789 7:19628557-19628579 GTTCCTCTGCCTTTGGAAAGGGG + Intergenic
1021616403 7:22506983-22507005 GCTCTTCTGCCTGTGCAAAGGGG + Intronic
1021641041 7:22736117-22736139 GGTTCTCTGCTTCTGAAAAGGGG + Intergenic
1022171432 7:27835733-27835755 GCTCCTCTGGTCTTGTAAAGAGG - Intronic
1022348304 7:29539478-29539500 TCTCCTCTGTCTTTGGAAAGGGG + Intergenic
1022366920 7:29730439-29730461 ACCCCTCTGCCTGGGGAAAGGGG - Intergenic
1022741076 7:33122466-33122488 GCTCATCTGCCTTTGGAAAGAGG - Intergenic
1022926200 7:35058195-35058217 GCTCTTCTGCCTGTGCAAAGGGG + Intergenic
1022993468 7:35730679-35730701 GCTCAGCTGCTTGTAGCAAGAGG + Intergenic
1023421786 7:39988143-39988165 GCTCCTATGCTTGGTGTAAGTGG - Exonic
1023754311 7:43401893-43401915 GCTCATCTGCTTGTGGAGCCTGG - Intronic
1024170337 7:46778402-46778424 GCTCCTCTGCCTTTGGAAATGGG + Intergenic
1024661212 7:51497188-51497210 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1024662376 7:51510776-51510798 GCCCCTCTGCCTGTGTAAAGGGG - Intergenic
1024891727 7:54211266-54211288 GATCCTCTGCCTTTGGAAAGCGG + Intergenic
1024956566 7:54926993-54927015 GCTCCTCTGCCTATGGAAAAGGG + Intergenic
1025138031 7:56436886-56436908 ACTCTTCTGCCTGTGGAAAGGGG + Intergenic
1027516018 7:79142830-79142852 GCTTCTCTGCTGGTGGAACAGGG - Intronic
1027604943 7:80288378-80288400 ACTGCTCTGCTTGTGGAAAGGGG + Intergenic
1027674760 7:81143590-81143612 ACTCCTCTGCTTGAGGAAATGGG + Intergenic
1027996166 7:85427513-85427535 GCTCCTCTGTCTGTGGAAAGGGG + Intergenic
1028160984 7:87484172-87484194 GCTCTCCTGCCTGTGGAAAGGGG + Intergenic
1028181541 7:87730466-87730488 ACTCTTCTGCTTGAGGAAAAGGG + Intronic
1028266523 7:88733251-88733273 ACGCCTCTGCTTGTGGAAATGGG - Intergenic
1028266635 7:88733907-88733929 TTCCCTCTGCTTGAGGAAAGGGG - Intergenic
1028376053 7:90147354-90147376 GCTCTTCTGCCTGTGCAAAGGGG - Intergenic
1028868049 7:95736367-95736389 ACTCCTCTGCTTGAGGAAAAGGG - Intergenic
1028929485 7:96397366-96397388 ACTCCTCTGCCTGGGGACAGGGG - Intergenic
1028950528 7:96630370-96630392 GCTCCTCTCTGTTTGGAAAGGGG - Intronic
1029203221 7:98853018-98853040 GAGCCTATGCTTGTGGAATGTGG - Intronic
1029797255 7:102909137-102909159 GTTCCTCTGCCTTTGGAAAGGGG - Intronic
1029824210 7:103172882-103172904 GCTCTTCTGCCTGTGCAAAGGGG + Intergenic
1030222511 7:107111171-107111193 GTTCCTCTGCTTAAGGAAAGGGG + Intronic
1030370437 7:108693892-108693914 GCTCCTATGCCTTTGGAAAGGGG - Intergenic
1030386533 7:108874061-108874083 GCTCTTCTGCTTGTGGAGCCTGG - Intergenic
1030391184 7:108930790-108930812 CCTCCTCTGCTTATGAAAAGGGG - Intergenic
1030408267 7:109142886-109142908 GCTCCTCTTCTTTTGGAAAGTGG - Intergenic
1030431545 7:109455287-109455309 GCTGTTCTGCTTGTGGAAATGGG - Intergenic
1030598929 7:111570975-111570997 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
1031231569 7:119114224-119114246 GCTCCTTTGCCTTTGGAAAGGGG - Intergenic
1031260131 7:119507513-119507535 ACTCTTCTGCTTGAGGAAAAGGG + Intergenic
1031288316 7:119900576-119900598 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1031472481 7:122182997-122183019 ACTCCTCTGCCTTTGGAAAGTGG + Intergenic
1031639063 7:124140001-124140023 GCTCCTCTGCCTTTGGAAAAGGG - Intergenic
1031657883 7:124380512-124380534 ACGCCTCTGCTTGTGGAAAGTGG + Intergenic
1031721989 7:125187730-125187752 CTTCTTCTGCTTGAGGAAAGGGG + Intergenic
1031753863 7:125612974-125612996 ACTCCCCTGCTTGAGGAAAGGGG + Intergenic
1031862350 7:126994646-126994668 GCTTCTCTGCCTGTGGAAAGGGG + Intronic
1031905879 7:127458980-127459002 ACTCCTCTACTTGTGGAAAGAGG + Intergenic
1032939181 7:136768620-136768642 GTTCCTCTGCCTGTGGTAAGGGG + Intergenic
1033489186 7:141824872-141824894 GCTCCCCTGCCTTTGGAAAGAGG - Intergenic
1033499944 7:141937430-141937452 GCTCCTCTGCCTGCAGAAAGGGG + Intronic
1033691381 7:143740682-143740704 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
1033833572 7:145282530-145282552 GCATCTCTGCCTTTGGAAAGTGG - Intergenic
1033882421 7:145902268-145902290 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1034003387 7:147442246-147442268 GCTCCTTTGCCTTTGGAAAGGGG - Intronic
1034126464 7:148675940-148675962 ACTCCTCTGCTCCTGTAAAGAGG + Intergenic
1034398120 7:150842766-150842788 GCTCCTCTGCCTGTGAGAATGGG + Intronic
1035084470 7:156246654-156246676 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1035550857 8:523702-523724 GCTCCTCTGCTTGTGGAAAGGGG + Intronic
1037421613 8:18709054-18709076 GCTGCTCGGGTTGTGGACAGCGG + Intronic
1038871838 8:31503751-31503773 GTTCCTCTGCCTTTGGAAAGAGG - Intergenic
1039002285 8:32995095-32995117 GCTCCTCTGCCTTTAGAAAGGGG - Intergenic
1039282057 8:35996940-35996962 GCTTCTCTGCCTTTGGAAAGAGG - Intergenic
1039647400 8:39303108-39303130 GCTCCTCTGCCCTTGCAAAGGGG - Intergenic
1039663694 8:39495956-39495978 GCTCCTTCGCTTGAGAAAAGTGG + Intergenic
1041500361 8:58533278-58533300 GCTTCTCTGCCTGTGGAAAGGGG + Intergenic
1041500374 8:58533372-58533394 GCTTCTCTACCTGTGGAAAGGGG - Intergenic
1041579850 8:59446611-59446633 GTTTCTCTGCATGTGCAAAGGGG - Intergenic
1041606975 8:59793116-59793138 ACTCCTATGCTTGAGGAAGGAGG + Intergenic
1041869210 8:62614743-62614765 GCCCCTCTGCCTTTGGAAAGGGG - Intronic
1041883292 8:62778441-62778463 ACTCCTCTGCTTGCGGAAAGGGG - Intronic
1042162680 8:65912787-65912809 GATCCTCTGCCTATGGAAAGGGG + Intergenic
1042297996 8:67242922-67242944 GCTCTTCTGCCTGTGAAAAGGGG + Intronic
1042726822 8:71888130-71888152 GCTCCTCTGCTTTTGGAAAGAGG - Intronic
1042898428 8:73695774-73695796 GTTCCTCTGCCTGTGGAAAGGGG + Intronic
1043042114 8:75276322-75276344 ACTCCTCTGCTTGAGGAAAGGGG + Intergenic
1043080137 8:75755886-75755908 AGTCCTCTGCCTGAGGAAAGGGG + Intergenic
1043214986 8:77574390-77574412 ACTCCTCTGCTTGTGAAAATGGG + Intergenic
1043366897 8:79543277-79543299 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
1043600383 8:81929674-81929696 GCTACTCTGCCTGTGGAAAGGGG + Intergenic
1043627042 8:82274089-82274111 GCTCCTGTGCCTTTGGAAAGGGG + Intergenic
1043653853 8:82636035-82636057 GCTCCTCTGTATTTTGAAAGAGG - Intergenic
1043701985 8:83300649-83300671 GCTCTTCTGCTAGTGGAACCTGG - Intergenic
1043740149 8:83801281-83801303 GCACTTCTGCCTGTGAAAAGGGG - Intergenic
1043760522 8:84062701-84062723 GCTCCTCTGCCTGTGGAAAGGGG - Intergenic
1043945953 8:86252767-86252789 GCTCCTCTGCCTTTGGAAAGGGG - Intronic
1043998064 8:86843450-86843472 GCTCCTCTGCCTGTGGAAAGGGG + Intergenic
1044395168 8:91702847-91702869 GCTCCTCTGCCTTTGGAAAGAGG - Intergenic
1044718119 8:95119920-95119942 GATCCTCCCATTGTGGAAAGAGG + Intergenic
1044785352 8:95787271-95787293 GCTCCTCTGCTGGGGGAAACTGG + Intergenic
1045041261 8:98227005-98227027 ACTCCTCTGCCTGGGGAAAGGGG - Intronic
1045172477 8:99686595-99686617 ACTCCACTGCTTGTGGAAAGTGG - Intronic
1045207145 8:100054909-100054931 GCTCCTCCACCTTTGGAAAGTGG + Intronic
1045589998 8:103582692-103582714 GCTCCTCTGCCTTTGGAAAGAGG + Intronic
1045621271 8:103980832-103980854 GCTCTTCTGCCTGTGGTAAGGGG + Intronic
1045777397 8:105821854-105821876 GCTCCTCTGAATTTGGAAAGGGG - Intergenic
1045994969 8:108351963-108351985 GCTCCTTTGCCTATGGAAAGGGG + Intronic
1046114103 8:109764969-109764991 GCTCCTCTCCCTTTGGAAAGGGG - Intergenic
1046384056 8:113486253-113486275 GTTCCTCTCCCTGTGGAAAGAGG - Intergenic
1046618432 8:116502131-116502153 GCTCCTTTTCTTCAGGAAAGTGG - Intergenic
1047343683 8:124006754-124006776 GCTGTGCTGTTTGTGGAAAGAGG - Intronic
1047352372 8:124088265-124088287 ACCCCTCTGCTTGAGGAAAGGGG - Intronic
1047781410 8:128114411-128114433 GCTGGTCTGACTGTGGAAAGAGG + Intergenic
1047933692 8:129753903-129753925 GCTCCTCTACCTGTGAAAAGGGG + Intronic
1048554880 8:135465678-135465700 TATCTTGTGCTTGTGGAAAGAGG - Intronic
1049618594 8:143587799-143587821 GCTCCTCTGCTGCTGGCCAGTGG - Intronic
1049753150 8:144295145-144295167 GAGCCTCTGCTGGTGGACAGAGG - Intronic
1050248236 9:3714099-3714121 GCTTCTCTGTCTGTGGTAAGAGG + Intergenic
1050384217 9:5068423-5068445 TCACCTTTGCTTGTGCAAAGAGG + Intronic
1050439190 9:5642630-5642652 TCTCCTCTGCCTGTGGACAGGGG - Intronic
1050508277 9:6369483-6369505 GCTCCTATGCCTGCAGAAAGGGG + Intergenic
1050578681 9:7027831-7027853 GCTCCTCTGCCAGTAGAAATGGG - Intronic
1050618566 9:7429121-7429143 ACTCCTCTGCTTGAGGAAGGGGG - Intergenic
1050722031 9:8601148-8601170 GTTCCTCTATCTGTGGAAAGGGG + Intronic
1050906858 9:11015864-11015886 TCTTCTCTACTTGAGGAAAGGGG - Intergenic
1051916794 9:22217852-22217874 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
1051921811 9:22275325-22275347 GCTCCTCTGCCTGTGGAAAGGGG + Intergenic
1051991032 9:23153212-23153234 GCTCCTCTGTCTTTAGAAAGGGG - Intergenic
1051992136 9:23163829-23163851 GCTCTTCTGCCTATGGAAAGGGG + Intergenic
1052063361 9:23987375-23987397 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
1052118769 9:24682254-24682276 ACCCCTCTTCTTGTGGAAACTGG + Intergenic
1052214587 9:25950953-25950975 GCTCCTCTGCCTTTGTAAAGGGG - Intergenic
1052585715 9:30425266-30425288 TTTCTTCTGCTTGAGGAAAGGGG - Intergenic
1052981268 9:34451437-34451459 GCTCCAGAGCGTGTGGAAAGGGG - Intronic
1053040110 9:34863030-34863052 GTTCCTCTGCTTGTAGAAAGGGG + Intergenic
1053110268 9:35453677-35453699 GCTCCTTTGCCTGTGGAAATGGG + Intergenic
1053204531 9:36174775-36174797 GCTCCTCTGCTTATGGAAAGGGG + Intergenic
1053357049 9:37455147-37455169 GCTCATCTGCCTGTGGAACCTGG - Intronic
1055579910 9:77697958-77697980 GCTCCTCTACCTGTAGAAAAGGG - Intergenic
1055692247 9:78845648-78845670 GTTCCTCTGCCTGTGGAAAGGGG - Intergenic
1055827068 9:80339578-80339600 ACTCCTCTGCTTGAGGAACGGGG + Intergenic
1055886414 9:81069152-81069174 GCTCGTCTGCCTGTGGAAAGGGG - Intergenic
1056003948 9:82247426-82247448 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1056007327 9:82286019-82286041 GCTTCTCTGCCTTTGAAAAGGGG + Intergenic
1056085752 9:83147972-83147994 GCTCATCTGCTTGTGGAGCCTGG + Intergenic
1056180427 9:84077050-84077072 GCTCCTCTGCTATGGAAAAGAGG + Intergenic
1056211199 9:84367117-84367139 GCTCCTCTGCCTTTGGAAAAGGG - Intergenic
1056424642 9:86464710-86464732 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1056516810 9:87359836-87359858 ACTCTTCTGCTTATGAAAAGAGG + Intergenic
1056957351 9:91092753-91092775 GCTCCTCTGACTTTGTAAAGGGG + Intergenic
1057289009 9:93788538-93788560 GTTCCTCTGCCTGTGGAAAGGGG - Intergenic
1057664733 9:97036473-97036495 CGTGCTCTGCTTTTGGAAAGTGG - Intronic
1058241650 9:102569657-102569679 GCACCTCTCCCTCTGGAAAGAGG + Intergenic
1058249026 9:102668628-102668650 GCTCCTCTGCCTATGAAAAGGGG - Intergenic
1058284976 9:103166416-103166438 GTTCCTCTGCCTTTGGAAATGGG - Intergenic
1058522748 9:105828377-105828399 ACTCCTCTGCTTGAGGAAAGGGG - Intergenic
1058552691 9:106132351-106132373 TCTCCTCAGCTTCTGGAAAAGGG - Intergenic
1058780219 9:108325604-108325626 GCTCTTCTGCTTTTGGAAAGGGG + Intergenic
1058901940 9:109449549-109449571 GCTCCTCTGCCTGGGGAGCGGGG + Intronic
1058927716 9:109684069-109684091 GCTTCTTTGCTTGTAGAAAGGGG + Intronic
1059555426 9:115276047-115276069 ACTCCTCTGCTTGTAGAAAGGGG - Intronic
1060084059 9:120680775-120680797 GCTCCTGTGCCTGTGGAAAGGGG - Intronic
1060304550 9:122398808-122398830 ACTCCTCTGCCTGTGGGAAGGGG + Intergenic
1061638345 9:131929669-131929691 GCTCTTCTGCCTGTGGAAAGGGG + Intronic
1062176213 9:135164451-135164473 GTTCCTCTGCCTGTGGAGGGAGG - Intergenic
1062232643 9:135490671-135490693 ACTGCTCTGCATGTGGATAGGGG - Intergenic
1062618097 9:137407161-137407183 GCCCCTCTGCTGGTGGAACCCGG + Intronic
1062625250 9:137439509-137439531 GCTCCTGGGCACGTGGAAAGTGG + Intronic
1185917618 X:4053233-4053255 GCTCTTCTGAATGTGGAAACTGG + Intergenic
1187090907 X:16095760-16095782 GATCCTCTGCCTATGGAAAGGGG - Intergenic
1187314869 X:18183770-18183792 ACTTCTCTGCTTGTAGAAACGGG + Intronic
1187579272 X:20591456-20591478 GCTCCTCTGCCAGTGGAAAGGGG - Intergenic
1187618651 X:21026759-21026781 GCTCCTCTGCCTTTGTAAAGGGG - Intergenic
1187652006 X:21420135-21420157 GATCCTCTGCCTTTGGAAAGGGG - Intronic
1188078462 X:25807524-25807546 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1188192005 X:27182801-27182823 ACTCCTCTGCTTGAGGAAATGGG + Intergenic
1188210679 X:27419710-27419732 GCTTCTCTGCTCTTGGAAAGGGG + Intergenic
1188651258 X:32634100-32634122 ACATCTCTGTTTGTGGAAAGGGG - Intronic
1188749956 X:33893115-33893137 GCTCCTCTGCCTTTGAAAAGGGG - Intergenic
1188807089 X:34604810-34604832 GCTCATCTGCTTGTGGAGCCTGG - Intergenic
1188846251 X:35076244-35076266 GCTCCTCTGCCTTTTGAAAAGGG - Intergenic
1188854196 X:35171928-35171950 GCTCTTCTGCTTGTGAAAAGGGG - Intergenic
1188924569 X:36023697-36023719 GTTCCTCTGCCTTTGGAATGGGG - Intergenic
1188930119 X:36098598-36098620 GCTTCTCTGCCTTTGGAAAGGGG - Intronic
1188932009 X:36123527-36123549 GCTCCTCTGCCTTCGGAGAGGGG - Intronic
1188972258 X:36632543-36632565 ACTCCTTTGCCTGAGGAAAGGGG - Intergenic
1189013405 X:37070662-37070684 GCTCTTGTGCCTGTGGAAAGGGG - Intergenic
1189019652 X:37320744-37320766 GCTTCACTGCCTTTGGAAAGGGG + Intergenic
1189405790 X:40721397-40721419 GCTCCTCTGCCTGTGGAAAGGGG + Intronic
1189411831 X:40779543-40779565 ACTCCTCTGCTTGTGGAAAGTGG - Intergenic
1189593901 X:42543873-42543895 GCTCCTCTGCCTGTGGAAAGGGG + Intergenic
1189630109 X:42943636-42943658 CCTCCTCTGCTTTTGTCAAGAGG - Intergenic
1189690514 X:43612860-43612882 GCTCCTCTGCCTTTGAAAAGGGG - Intergenic
1189858392 X:45247489-45247511 GCTTCTCTGCCTTTGGAAAGGGG - Intergenic
1189868743 X:45360252-45360274 GCTCCTCTGCCTTTGGAAATGGG - Intergenic
1189870078 X:45371976-45371998 GCTCCTCTGCCTATGAAAAGGGG + Intergenic
1189874296 X:45420098-45420120 ACTCCTCTGCTTGTGGAAAGAGG - Intergenic
1189875634 X:45433501-45433523 ACCCCTCTGCTTGAGGAAAAGGG - Intergenic
1189881421 X:45497600-45497622 GCTACTCTGCCTTTAGAAAGGGG - Intergenic
1190015176 X:46820268-46820290 CCTCCTCTGCCTGTGGAAAGGGG + Intergenic
1190037866 X:47042606-47042628 ACTCCTCTGCATGAGGAAAGGGG + Intronic
1190046313 X:47113879-47113901 ACTCCTTTGCTTATGGAAAGGGG + Intergenic
1190374287 X:49774372-49774394 GCTCCTCTGCCTGTGGAAGGAGG - Intergenic
1190498540 X:51053001-51053023 GCTCCTCTGCCTTTGAAAAGGGG - Intergenic
1190602646 X:52108417-52108439 ACTCCTCTACTTGAGGATAGGGG - Intergenic
1190614643 X:52217700-52217722 GCTCCTCTGCATTTGGAAAGAGG + Intergenic
1191083455 X:56538291-56538313 GCTCCTCTGCCTTTGGAAAAAGG + Intergenic
1191198662 X:57752703-57752725 GTTCCTCTGCATTTGGAAAGGGG + Intergenic
1191207378 X:57849308-57849330 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1191694657 X:63977583-63977605 ACTCCTCTGTCTTTGGAAAGGGG + Intergenic
1191972600 X:66833325-66833347 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
1192027192 X:67466268-67466290 GCTTTTCTGCCTTTGGAAAGGGG + Intergenic
1192062217 X:67839140-67839162 GCTCCTCTGTCTTTGAAAAGGGG + Intergenic
1192077926 X:68018799-68018821 GCTCCTCTGCCTTTGCAGAGGGG + Intergenic
1192135113 X:68589570-68589592 GCTCCTCTGCTGGTGGAAAGGGG + Intergenic
1192374929 X:70549673-70549695 ACTCTTCTGCGTGTGGAAAGAGG + Intronic
1192393457 X:70754349-70754371 GTTCCTCTGCCTTTGGAAAGGGG + Intronic
1192397339 X:70795236-70795258 ACTCCTCTGCTTGTGGAAAGAGG + Intronic
1192640764 X:72859741-72859763 GCTTCTCTTCCTGTGGAAAGGGG + Intergenic
1192640947 X:72861035-72861057 GCTTCTCTTCCTGTGGAAAGGGG - Intergenic
1192812611 X:74560370-74560392 ACTCCTCTGCCTTTAGAAAGGGG + Intergenic
1192822356 X:74658344-74658366 ACTCCTCTGCCTTTGGAAAGGGG - Intergenic
1192836175 X:74801966-74801988 GCTCCTCTGCCTGTGGAAATGGG + Intronic
1192855916 X:75011732-75011754 GCTCCTCTGCCTTTGGAAATGGG - Intergenic
1192863816 X:75108104-75108126 GCTCCTCTGATTTTGGCAAGGGG + Intronic
1193012894 X:76697335-76697357 GCGTCTCTGCCTTTGGAAAGGGG + Intergenic
1193052351 X:77115009-77115031 ACTCCTCTGCCTGGGAAAAGGGG - Intergenic
1193092617 X:77510698-77510720 ACTCCTTTGCTTGTGAAAAGCGG + Intronic
1193161838 X:78237598-78237620 GCTACTCTGCCTTTTGAAAGGGG - Intergenic
1193167820 X:78302151-78302173 GCTCCTCTGCCTTTGAAAAGGGG - Intronic
1193172985 X:78358140-78358162 GCTCCTCTGCCTTTGGAAATGGG - Intergenic
1193175220 X:78384512-78384534 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
1193210105 X:78797426-78797448 GCTCCTCTGCTTGTGGAAAGAGG - Intergenic
1193215647 X:78860881-78860903 GCTCCTCTGCCTATGGAAAGGGG + Intergenic
1193220013 X:78913305-78913327 GCTCCTTTGTCTGTTGAAAGGGG - Intergenic
1193252595 X:79309450-79309472 GCTCCTCCCCCTTTGGAAAGAGG + Intergenic
1193260832 X:79404407-79404429 GCTCCTCTGACTTTGGAAAGGGG + Intergenic
1193280292 X:79641168-79641190 ACTCCTCTGCCTGGAGAAAGGGG - Intergenic
1193300050 X:79878996-79879018 GCTCCTCTACCCTTGGAAAGGGG + Intergenic
1193305836 X:79950026-79950048 ACTCCTCTGCCTGTAAAAAGTGG + Intergenic
1193337334 X:80306497-80306519 GCTCATCTGTCTTTGGAAAGGGG - Intergenic
1193417127 X:81238398-81238420 GCACCTCTGCCTTTGGAAAGTGG + Intronic
1193441094 X:81539716-81539738 ACTCCTCTACTTGTGGAAAGTGG + Intergenic
1193487291 X:82102495-82102517 GCTCTTCTGCTTTTGAAAAGGGG - Intergenic
1193488269 X:82115139-82115161 GTTCCTCTGCTTGTGTAAATGGG - Intergenic
1193524452 X:82572485-82572507 GCTCCTCTGCTTTTGAAAAGGGG - Intergenic
1193555730 X:82951634-82951656 GTCCCTCTGCCTTTGGAAAGGGG - Intergenic
1193580547 X:83258474-83258496 GTTTCTCTGCCTGTAGAAAGGGG + Intergenic
1193664642 X:84300486-84300508 GCTCCTGTGCCTTTGGAAAGGGG + Intergenic
1193665466 X:84310384-84310406 GCTCCTCTGCATTTGGAAAGAGG + Intergenic
1193683680 X:84552430-84552452 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1193697201 X:84723794-84723816 GATCCTCTGCCTTTGGAAAAGGG - Intergenic
1193815786 X:86102913-86102935 GCTTCTATGCCTTTGGAAAGGGG + Intergenic
1193877882 X:86884516-86884538 GCTCCTCTGCCTTTGCAACGAGG - Intergenic
1193894893 X:87100872-87100894 ACTCCTCTGACTGTGGAAAGGGG + Intergenic
1193897068 X:87127422-87127444 ACTCCTCTGCTTGAGGAAAGGGG + Intergenic
1193907623 X:87261960-87261982 GCTCCTCCGCCTTTGGAAAGAGG + Intergenic
1193911931 X:87316785-87316807 TCTTCTCTGCCTGTGTAAAGGGG - Intergenic
1193925185 X:87475940-87475962 GCTCCTCTGCTTTTGAAAAGGGG - Intergenic
1193930314 X:87544226-87544248 GTTCCTCTGCCTTTGGAAAGGGG + Intronic
1193957877 X:87885514-87885536 GGTCCTCTGCCTTTGGAAAGAGG - Intergenic
1194023591 X:88723971-88723993 GTTCCTCTGCCTTTGGAAAAAGG + Intergenic
1194083528 X:89498497-89498519 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1194157825 X:90415310-90415332 GCTGCTCTGCCTTTGGAAAGAGG - Intergenic
1194163392 X:90483601-90483623 GCTCTTCTGCTCGTGGAACCTGG + Intergenic
1194196662 X:90903028-90903050 GCTCCTCTGCCTATGAAAAGTGG - Intergenic
1194218861 X:91167268-91167290 GCTCCTCTGCCTTTATAAAGTGG - Intergenic
1194223686 X:91227812-91227834 GCTCCCCTGCTTTTGGAAAGTGG + Intergenic
1194228085 X:91286780-91286802 GTTCTGCTGCTTGTAGAAAGGGG + Intergenic
1194285632 X:92007348-92007370 GCTCCTCTGCCTTTGGAAAGAGG - Intronic
1194288478 X:92039453-92039475 GCTCCTCTGCCTGTGAAAAGGGG - Intronic
1194327655 X:92540298-92540320 GTTCCTCTGCCTGTGGAAAGAGG - Intronic
1194329262 X:92560690-92560712 ACTCCTCTGCCTTTGTAAAGGGG + Intronic
1194338655 X:92682053-92682075 GCTCCTCTGCCTGTGGAAAGGGG - Intergenic
1194352289 X:92835146-92835168 ACTCCTCTGCCTCTGAAAAGGGG + Intergenic
1194358463 X:92918082-92918104 GCTCCTGTGCCTTTGGAAAGGGG - Intergenic
1194372455 X:93090964-93090986 GCGCCTCTGCCTTTGGATAGGGG - Intergenic
1194393146 X:93346323-93346345 GCTTCTCTGCCTTTGGAAAAGGG - Intergenic
1194457528 X:94123507-94123529 GCTCCTCTGCATTTGGAAAGGGG - Intergenic
1194476938 X:94369750-94369772 GCTCCTCTGCCTTTGGAAGAAGG + Intergenic
1194479302 X:94400859-94400881 GCTTCTCTGCCTGTAGAAAGGGG - Intergenic
1194495534 X:94613032-94613054 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1194500828 X:94679093-94679115 GCTCTTCTACCTGTGGAAAGGGG - Intergenic
1194526536 X:94983916-94983938 GCTACTCTCCATGTGGAAAGGGG + Intergenic
1194532568 X:95069312-95069334 GCTCCTCTATATTTGGAAAGAGG + Intergenic
1194574628 X:95596663-95596685 GTTCCTCTACCTTTGGAAAGGGG + Intergenic
1194595204 X:95848546-95848568 GCATCTCTGCTTTTGGAAACAGG + Intergenic
1194692870 X:97009164-97009186 CCTCCTCTGCTTGTGAAAAGGGG - Intronic
1194780735 X:98022900-98022922 GCTCCTCTGCCTGTGGAAAGGGG - Intergenic
1194783794 X:98057667-98057689 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1194788774 X:98119306-98119328 GCTCCTCAGCCTTTGGAAGGGGG + Intergenic
1194795938 X:98210981-98211003 GCTCCTCTGCCTGCAGAAAGGGG + Intergenic
1194831862 X:98632600-98632622 GCTCCTCTGTCTTTGGAAAGAGG + Intergenic
1194857810 X:98956161-98956183 GCTTCTCTGCCTTTGGAAAGGGG - Intergenic
1194928869 X:99862437-99862459 GATCCTCTGCCTTTGGAAAGGGG + Intergenic
1195014602 X:100766077-100766099 GAACCTCTGCCTTTGGAAAGGGG - Intergenic
1195090064 X:101450306-101450328 GCTTATCTGCCTGTGGGAAGGGG - Intronic
1195115821 X:101696763-101696785 GCTCCTCTGCATGTGGAAAGGGG + Intergenic
1195199415 X:102533191-102533213 GCTCTACTGACTGTGGAAAGGGG + Intergenic
1195224982 X:102783951-102783973 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1195289992 X:103423430-103423452 AGTCCTCTGCCTGTGGAAAGGGG - Intergenic
1195396198 X:104412729-104412751 ACTCTTCTGCTTGTGGGAAAGGG + Intergenic
1195543285 X:106087338-106087360 GCTTCTCTGTCTATGGAAAGGGG - Intergenic
1195559370 X:106266040-106266062 GCTCCTCAACATTTGGAAAGGGG - Intergenic
1195823381 X:108970818-108970840 ACTCCTCTGCATGAGGAAAGGGG + Intergenic
1195852105 X:109294834-109294856 GCTCTTCTGCCTTTGGAGAGGGG - Intergenic
1195917279 X:109948145-109948167 ACTCCTCTGCTTGTGGAAAGGGG + Intergenic
1196096706 X:111808383-111808405 ACTCCTCAGCTTATGAAAAGGGG - Intronic
1196214454 X:113034805-113034827 GGTCCTCTCCCTTTGGAAAGGGG - Intergenic
1196226256 X:113170979-113171001 GCTCCTTTGCCTTTGGAAAGGGG - Intergenic
1196247448 X:113416004-113416026 GCACCTCTGCCTCTGGAAAATGG + Intergenic
1196255705 X:113515786-113515808 TCTACTCTCCTTGAGGAAAGAGG + Intergenic
1196304703 X:114087440-114087462 GCTCCTCTGCATGTGGAAGGTGG + Intergenic
1196385143 X:115140746-115140768 GTTCCTCTACCTGTGGAAAGGGG + Intronic
1196466227 X:115973757-115973779 GCTCTTCTGCCTTTGGAAACGGG + Intergenic
1196471281 X:116031452-116031474 ATTCCTCTGCATTTGGAAAGGGG - Intergenic
1196479879 X:116135745-116135767 GCTCCTTTGCCTATAGAAAGGGG - Intergenic
1196485543 X:116203102-116203124 GCTACTATGCCTTTGGAAAGGGG - Intergenic
1196495410 X:116318448-116318470 GCTCCTCTGCCTGTAGAAAGGGG + Intergenic
1196512046 X:116523552-116523574 AATCCTCTGCTTGTGGAAAGGGG - Intergenic
1196517650 X:116631725-116631747 GCTCCTCTGCCTTTGGAAAAGGG + Intergenic
1196523769 X:116707376-116707398 GCTCTTCTGCCTTTGGACAGGGG - Intergenic
1196538909 X:116882411-116882433 GCTCCTTTGCATTTGGAAAGGGG - Intergenic
1196552566 X:117046074-117046096 GCTCTTCTGTCTGTGGAAAGGGG + Intergenic
1196579126 X:117359017-117359039 GCTTTTCTGCCTTTGGAAAGGGG - Intergenic
1196591005 X:117485205-117485227 GTTCTTCTGCCTTTGGAAAGGGG - Intergenic
1196600873 X:117600558-117600580 CCTCCTCTGCCTTAGGAAAGGGG - Intergenic
1196609619 X:117696134-117696156 GCTTCTCTGCCTTTGAAAAGAGG + Intergenic
1196660579 X:118264607-118264629 GCTCCTCTGCCTTTGGAAAGGGG + Intergenic
1196861540 X:120033485-120033507 GCTCATCTGCTTGTGGATCCTGG - Intergenic
1196865411 X:120066372-120066394 GCTCCTTTGCCTTTGGAAAGGGG + Intergenic
1196877683 X:120169908-120169930 GCTCCTTTGCCTTTGGAAAGGGG - Intergenic
1196984488 X:121253541-121253563 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1197011636 X:121571014-121571036 ACTCTTCTGCATGTGGAAAAGGG + Intergenic
1197052517 X:122077142-122077164 GCTCCTCTGCCTGTAGAAAGAGG - Intergenic
1197075796 X:122350924-122350946 GCCCCTCTGCCTTTGGAAAGGGG + Intergenic
1197096733 X:122604886-122604908 TCTCCTCTGCCTTTGGAAAGGGG + Intergenic
1197099511 X:122636345-122636367 ACTCCTCTGCTTGAGGAAAGGGG - Intergenic
1197112984 X:122798026-122798048 GCTCCTTTGCCTTTGGAAAGGGG + Intergenic
1197376048 X:125682804-125682826 TCTCCTCTGCCTGGGAAAAGGGG + Intergenic
1197382715 X:125765388-125765410 ATTCCTCTGCTTGTGAAAAGTGG - Intergenic
1197429490 X:126342793-126342815 GCTCCTCTGCTTTTGGAAAGGGG + Intergenic
1197438025 X:126456349-126456371 CCTCCTCTGCATTTGGAAAGAGG + Intergenic
1197449493 X:126594291-126594313 GCTCCTCTGCCTTTGGGAAGGGG - Intergenic
1197458037 X:126702009-126702031 GCTCCTCTGCCTGTTGAAAGGGG + Intergenic
1197458390 X:126707052-126707074 GCTTCTCTGCCTTTGGAAAGGGG + Intergenic
1197488813 X:127090231-127090253 ACACCTCTGCTTGTGGAAAATGG - Intergenic
1197520330 X:127489826-127489848 GCTCCTCTGTCTGTAAAAAGGGG - Intergenic
1197561969 X:128034805-128034827 GCACTTCTTCCTGTGGAAAGGGG + Intergenic
1197810776 X:130441420-130441442 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1198430754 X:136564460-136564482 GCTCCTTTGCATGTAGAAAGGGG - Intergenic
1198537621 X:137601735-137601757 GCTCCTCTGCCTGTGGAAATGGG + Intergenic
1198664438 X:139004823-139004845 GCTTCTCTGCCTGTGGAATGGGG + Intronic
1198694926 X:139325356-139325378 ACTCCTCTGCCTTTGGAAAGGGG + Intergenic
1198773606 X:140156235-140156257 GCTCCTCTGCCTGTGGGAAGGGG + Intergenic
1198818021 X:140614083-140614105 GCTCCTCTCCCTTTGGAAAGAGG - Intergenic
1198841082 X:140858864-140858886 GGTCTTTTGCCTGTGGAAAGGGG + Intergenic
1198925546 X:141788051-141788073 GCTCCTCAGCCTTTGGAAAGGGG - Intergenic
1198927404 X:141814595-141814617 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1198947513 X:142031165-142031187 ACTCCTCTGCCTGTTGAAAGGGG - Intergenic
1198996172 X:142576978-142577000 GTTCCTCTGCCGTTGGAAAGGGG - Intergenic
1199018412 X:142847264-142847286 GGACCTCTGACTGTGGAAAGGGG - Intergenic
1199076172 X:143529562-143529584 GCTCCCCTGCCTTTGGAAAAGGG - Intergenic
1199081203 X:143578843-143578865 GCTCCTCTGCCTTTGGAAAAGGG - Intergenic
1199159871 X:144596672-144596694 GCTCCTCTGCCTTAGGAAGGGGG - Intergenic
1199191870 X:144980552-144980574 TCTCCCCTGCCTTTGGAAAGGGG + Intergenic
1199197540 X:145048546-145048568 GCTACTCTGCCTGTAAAAAGGGG + Intergenic
1199217876 X:145282051-145282073 GCTCCTCTACTTTTGGGAAGGGG - Intergenic
1199239192 X:145526644-145526666 GCTCCTCTGCCTTTAGAAAGGGG + Intergenic
1199247728 X:145625893-145625915 GCTCCTCTGCTTTTGGAAAAAGG + Intergenic
1199258607 X:145745028-145745050 GCTCTTCTGCCTTTGGAAAGGGG + Intergenic
1199277686 X:145964979-145965001 GTTCCTCTGCTTGTGAAAAGGGG + Intergenic
1199317281 X:146395542-146395564 GCTCCACTGCTTTTGGAAAGTGG - Intergenic
1199439594 X:147853846-147853868 ACTCCTCTGCTTGTGGAAAGGGG - Intergenic
1199441032 X:147867611-147867633 GCTTCTCTGCCTCTGGAAAGAGG + Intergenic
1199443004 X:147889814-147889836 GCTCCTCTGACTTTGGAAAGGGG - Intergenic
1199455138 X:148020144-148020166 GCTCTTCTGCCTGTAGAAAGGGG - Intronic
1199485153 X:148338801-148338823 GCTCCTCTACCTGTGGAAACGGG + Intergenic
1199568726 X:149246192-149246214 ACTCCTCTGCTTGAAGAAAAGGG - Intergenic
1199645807 X:149909633-149909655 GCTCCTCTGCCTATGGAAAAGGG + Intergenic
1199845324 X:151688617-151688639 TGACCTCTGCTTGGGGAAAGAGG + Intergenic
1199908506 X:152260141-152260163 GCTCCTCTGCCTATGAAAAGGGG + Intronic
1200089208 X:153626488-153626510 CTGCCTCTGCTTGAGGAAAGGGG - Intergenic
1200177424 X:154126577-154126599 GGTTCTCTGCCTGTGGAAAAGGG + Intergenic
1200315930 X:155132995-155133017 GCACCTCTGCCTGTGGAAGGGGG + Intronic
1200364280 X:155644887-155644909 ATTCCTCTGCTTGAGAAAAGTGG - Intronic
1200436177 Y:3154378-3154400 GCTCCTCTGCCTTTGGAAAGGGG - Intergenic
1200504157 Y:3992279-3992301 ACTGCTCTGCCTTTGGAAAGAGG - Intergenic
1200542507 Y:4477229-4477251 GCTCCTCTGCCTATGAAAAGTGG - Intergenic
1200555369 Y:4631022-4631044 GCTCCTCTGCCTTTATAAAGTGG - Intergenic
1200560151 Y:4691194-4691216 GCTCCCCTGCTTTTGGAAAGTGG + Intergenic
1200603197 Y:5231887-5231909 GCTCCTCTGCCTTTGGAAAGAGG - Intronic
1200605997 Y:5264018-5264040 GCTCCTCTGCCTGTGAAAAGGGG - Intronic
1200636366 Y:5659516-5659538 GTTCCTCTGCCTGTGGAAAGAGG - Intronic
1200637961 Y:5679879-5679901 ACTCCTCTGCCTTTGTAAAGGGG + Intronic
1200647046 Y:5798835-5798857 GCTCCTCTGCCTGTGGAAAGGGG - Intergenic
1200660597 Y:5951884-5951906 ACTCCTCTGCCTCTGAAAAGGGG + Intergenic
1200666643 Y:6033773-6033795 GTTCCTGTGCCTTTGGAAAGGGG - Intergenic
1200680497 Y:6205007-6205029 GCGCCTCTGCCTTTGGATAGGGG - Intergenic
1201751518 Y:17436804-17436826 GCTCCTCTGCTTGTAGAGCCTGG + Intergenic
1202042695 Y:20701686-20701708 GTTCCTCTGTCTTTGGAAAGTGG + Intergenic
1202595486 Y:26534949-26534971 GCTCCTCTGCCTTTGGACAGTGG + Intergenic