ID: 1010650892

View in Genome Browser
Species Human (GRCh38)
Location 6:78454752-78454774
Sequence TGAGTTCTTACAATATATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010650892_1010650893 -4 Left 1010650892 6:78454752-78454774 CCATCATATATTGTAAGAACTCA No data
Right 1010650893 6:78454771-78454793 CTCACTCATGATCACCAGAATGG No data
1010650892_1010650894 1 Left 1010650892 6:78454752-78454774 CCATCATATATTGTAAGAACTCA No data
Right 1010650894 6:78454776-78454798 TCATGATCACCAGAATGGCATGG No data
1010650892_1010650896 18 Left 1010650892 6:78454752-78454774 CCATCATATATTGTAAGAACTCA No data
Right 1010650896 6:78454793-78454815 GCATGGAAGTAACTGCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010650892 Original CRISPR TGAGTTCTTACAATATATGA TGG (reversed) Intergenic
No off target data available for this crispr