ID: 1010651240

View in Genome Browser
Species Human (GRCh38)
Location 6:78457631-78457653
Sequence TTGGATGAATAAATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010651240_1010651243 -5 Left 1010651240 6:78457631-78457653 CCCTGCTCCATTTATTCATCCAA No data
Right 1010651243 6:78457649-78457671 TCCAACACGTATTTATTGAGTGG No data
1010651240_1010651245 10 Left 1010651240 6:78457631-78457653 CCCTGCTCCATTTATTCATCCAA No data
Right 1010651245 6:78457664-78457686 TTGAGTGGTGACTACCTGTCAGG No data
1010651240_1010651247 30 Left 1010651240 6:78457631-78457653 CCCTGCTCCATTTATTCATCCAA No data
Right 1010651247 6:78457684-78457706 AGGCACCAACCTACATGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010651240 Original CRISPR TTGGATGAATAAATGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr