ID: 1010654188

View in Genome Browser
Species Human (GRCh38)
Location 6:78492479-78492501
Sequence GCCTCATGCTGCTGCTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010654188_1010654193 17 Left 1010654188 6:78492479-78492501 CCAAGTCAGCAGCAGCATGAGGC No data
Right 1010654193 6:78492519-78492541 GCAGCTGGTCACTGACATCCAGG No data
1010654188_1010654192 2 Left 1010654188 6:78492479-78492501 CCAAGTCAGCAGCAGCATGAGGC No data
Right 1010654192 6:78492504-78492526 GAGGTCAGTTCGCAGGCAGCTGG No data
1010654188_1010654190 -5 Left 1010654188 6:78492479-78492501 CCAAGTCAGCAGCAGCATGAGGC No data
Right 1010654190 6:78492497-78492519 GAGGCCTGAGGTCAGTTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010654188 Original CRISPR GCCTCATGCTGCTGCTGACT TGG (reversed) Intergenic
No off target data available for this crispr