ID: 1010654190

View in Genome Browser
Species Human (GRCh38)
Location 6:78492497-78492519
Sequence GAGGCCTGAGGTCAGTTCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010654188_1010654190 -5 Left 1010654188 6:78492479-78492501 CCAAGTCAGCAGCAGCATGAGGC No data
Right 1010654190 6:78492497-78492519 GAGGCCTGAGGTCAGTTCGCAGG No data
1010654185_1010654190 10 Left 1010654185 6:78492464-78492486 CCCTTCAGGAATTATCCAAGTCA No data
Right 1010654190 6:78492497-78492519 GAGGCCTGAGGTCAGTTCGCAGG No data
1010654183_1010654190 25 Left 1010654183 6:78492449-78492471 CCAAGGGCTTTGCTGCCCTTCAG No data
Right 1010654190 6:78492497-78492519 GAGGCCTGAGGTCAGTTCGCAGG No data
1010654186_1010654190 9 Left 1010654186 6:78492465-78492487 CCTTCAGGAATTATCCAAGTCAG No data
Right 1010654190 6:78492497-78492519 GAGGCCTGAGGTCAGTTCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010654190 Original CRISPR GAGGCCTGAGGTCAGTTCGC AGG Intergenic
No off target data available for this crispr