ID: 1010654192

View in Genome Browser
Species Human (GRCh38)
Location 6:78492504-78492526
Sequence GAGGTCAGTTCGCAGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010654186_1010654192 16 Left 1010654186 6:78492465-78492487 CCTTCAGGAATTATCCAAGTCAG No data
Right 1010654192 6:78492504-78492526 GAGGTCAGTTCGCAGGCAGCTGG No data
1010654188_1010654192 2 Left 1010654188 6:78492479-78492501 CCAAGTCAGCAGCAGCATGAGGC No data
Right 1010654192 6:78492504-78492526 GAGGTCAGTTCGCAGGCAGCTGG No data
1010654185_1010654192 17 Left 1010654185 6:78492464-78492486 CCCTTCAGGAATTATCCAAGTCA No data
Right 1010654192 6:78492504-78492526 GAGGTCAGTTCGCAGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010654192 Original CRISPR GAGGTCAGTTCGCAGGCAGC TGG Intergenic
No off target data available for this crispr