ID: 1010654193

View in Genome Browser
Species Human (GRCh38)
Location 6:78492519-78492541
Sequence GCAGCTGGTCACTGACATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010654191_1010654193 -5 Left 1010654191 6:78492501-78492523 CCTGAGGTCAGTTCGCAGGCAGC No data
Right 1010654193 6:78492519-78492541 GCAGCTGGTCACTGACATCCAGG No data
1010654188_1010654193 17 Left 1010654188 6:78492479-78492501 CCAAGTCAGCAGCAGCATGAGGC No data
Right 1010654193 6:78492519-78492541 GCAGCTGGTCACTGACATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010654193 Original CRISPR GCAGCTGGTCACTGACATCC AGG Intergenic
No off target data available for this crispr