ID: 1010655173

View in Genome Browser
Species Human (GRCh38)
Location 6:78503316-78503338
Sequence GGTGCTCAGCAACCACATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010655162_1010655173 29 Left 1010655162 6:78503264-78503286 CCTTTTAATTCACCTCTTCCCTA No data
Right 1010655173 6:78503316-78503338 GGTGCTCAGCAACCACATGCAGG No data
1010655164_1010655173 17 Left 1010655164 6:78503276-78503298 CCTCTTCCCTAGGAGCTGCTTGG No data
Right 1010655173 6:78503316-78503338 GGTGCTCAGCAACCACATGCAGG No data
1010655168_1010655173 11 Left 1010655168 6:78503282-78503304 CCCTAGGAGCTGCTTGGGGACAG No data
Right 1010655173 6:78503316-78503338 GGTGCTCAGCAACCACATGCAGG No data
1010655169_1010655173 10 Left 1010655169 6:78503283-78503305 CCTAGGAGCTGCTTGGGGACAGG No data
Right 1010655173 6:78503316-78503338 GGTGCTCAGCAACCACATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010655173 Original CRISPR GGTGCTCAGCAACCACATGC AGG Intergenic
No off target data available for this crispr