ID: 1010661846

View in Genome Browser
Species Human (GRCh38)
Location 6:78580699-78580721
Sequence CAGCTGTTCTAAAAAACATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010661845_1010661846 11 Left 1010661845 6:78580665-78580687 CCAGTTTGAGCAATTACATCAGT No data
Right 1010661846 6:78580699-78580721 CAGCTGTTCTAAAAAACATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010661846 Original CRISPR CAGCTGTTCTAAAAAACATA AGG Intergenic
No off target data available for this crispr