ID: 1010665557

View in Genome Browser
Species Human (GRCh38)
Location 6:78625902-78625924
Sequence CTGTTCCAGGGTAAGATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010665557_1010665560 -10 Left 1010665557 6:78625902-78625924 CCTCAAATCTTACCCTGGAACAG No data
Right 1010665560 6:78625915-78625937 CCTGGAACAGATTCACTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010665557 Original CRISPR CTGTTCCAGGGTAAGATTTG AGG (reversed) Intergenic
No off target data available for this crispr