ID: 1010665906

View in Genome Browser
Species Human (GRCh38)
Location 6:78629615-78629637
Sequence ACCGAAGGCACCAACAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010665898_1010665906 24 Left 1010665898 6:78629568-78629590 CCGCATAAAAAAGCGCAGTCTGG No data
Right 1010665906 6:78629615-78629637 ACCGAAGGCACCAACAGCTAAGG No data
1010665904_1010665906 -8 Left 1010665904 6:78629600-78629622 CCACAGGGCAGCTGTACCGAAGG No data
Right 1010665906 6:78629615-78629637 ACCGAAGGCACCAACAGCTAAGG No data
1010665902_1010665906 1 Left 1010665902 6:78629591-78629613 CCGCTTTTCCCACAGGGCAGCTG No data
Right 1010665906 6:78629615-78629637 ACCGAAGGCACCAACAGCTAAGG No data
1010665903_1010665906 -7 Left 1010665903 6:78629599-78629621 CCCACAGGGCAGCTGTACCGAAG No data
Right 1010665906 6:78629615-78629637 ACCGAAGGCACCAACAGCTAAGG No data
1010665897_1010665906 25 Left 1010665897 6:78629567-78629589 CCCGCATAAAAAAGCGCAGTCTG No data
Right 1010665906 6:78629615-78629637 ACCGAAGGCACCAACAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010665906 Original CRISPR ACCGAAGGCACCAACAGCTA AGG Intergenic
No off target data available for this crispr