ID: 1010666615

View in Genome Browser
Species Human (GRCh38)
Location 6:78638238-78638260
Sequence CTCAAATAGTAATCTGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010666615_1010666625 21 Left 1010666615 6:78638238-78638260 CCCTTTCCAGATTACTATTTGAG No data
Right 1010666625 6:78638282-78638304 CACTCCAGTGGAAAGTAAGATGG No data
1010666615_1010666619 -7 Left 1010666615 6:78638238-78638260 CCCTTTCCAGATTACTATTTGAG No data
Right 1010666619 6:78638254-78638276 ATTTGAGGATTACACAACCCTGG No data
1010666615_1010666620 9 Left 1010666615 6:78638238-78638260 CCCTTTCCAGATTACTATTTGAG No data
Right 1010666620 6:78638270-78638292 ACCCTGGCCCTTCACTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010666615 Original CRISPR CTCAAATAGTAATCTGGAAA GGG (reversed) Intergenic
No off target data available for this crispr