ID: 1010671834

View in Genome Browser
Species Human (GRCh38)
Location 6:78695239-78695261
Sequence CTGAGGGTCTGACTGTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010671829_1010671834 2 Left 1010671829 6:78695214-78695236 CCAGCAAACTCCAACAGACCTGC 0: 2027
1: 2137
2: 1209
3: 617
4: 560
Right 1010671834 6:78695239-78695261 CTGAGGGTCTGACTGTTAGAAGG No data
1010671826_1010671834 30 Left 1010671826 6:78695186-78695208 CCAGGCAAACAGGGTCTGGAGGG 0: 24
1: 2959
2: 2371
3: 1172
4: 783
Right 1010671834 6:78695239-78695261 CTGAGGGTCTGACTGTTAGAAGG No data
1010671832_1010671834 -8 Left 1010671832 6:78695224-78695246 CCAACAGACCTGCAGCTGAGGGT 0: 4404
1: 2213
2: 959
3: 875
4: 935
Right 1010671834 6:78695239-78695261 CTGAGGGTCTGACTGTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010671834 Original CRISPR CTGAGGGTCTGACTGTTAGA AGG Intergenic
No off target data available for this crispr