ID: 1010673507

View in Genome Browser
Species Human (GRCh38)
Location 6:78715026-78715048
Sequence TGACCTGTGTTAAGAAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010673507_1010673513 18 Left 1010673507 6:78715026-78715048 CCACCTCTTCTTAACACAGGTCA No data
Right 1010673513 6:78715067-78715089 CCTTTCACTCTCCCAATGGCAGG No data
1010673507_1010673511 14 Left 1010673507 6:78715026-78715048 CCACCTCTTCTTAACACAGGTCA No data
Right 1010673511 6:78715063-78715085 GATGCCTTTCACTCTCCCAATGG No data
1010673507_1010673514 27 Left 1010673507 6:78715026-78715048 CCACCTCTTCTTAACACAGGTCA No data
Right 1010673514 6:78715076-78715098 CTCCCAATGGCAGGCATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010673507 Original CRISPR TGACCTGTGTTAAGAAGAGG TGG (reversed) Intergenic
No off target data available for this crispr