ID: 1010673511

View in Genome Browser
Species Human (GRCh38)
Location 6:78715063-78715085
Sequence GATGCCTTTCACTCTCCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010673507_1010673511 14 Left 1010673507 6:78715026-78715048 CCACCTCTTCTTAACACAGGTCA No data
Right 1010673511 6:78715063-78715085 GATGCCTTTCACTCTCCCAATGG No data
1010673504_1010673511 27 Left 1010673504 6:78715013-78715035 CCTGCCAAAGAGACCACCTCTTC No data
Right 1010673511 6:78715063-78715085 GATGCCTTTCACTCTCCCAATGG No data
1010673508_1010673511 11 Left 1010673508 6:78715029-78715051 CCTCTTCTTAACACAGGTCAGTC No data
Right 1010673511 6:78715063-78715085 GATGCCTTTCACTCTCCCAATGG No data
1010673505_1010673511 23 Left 1010673505 6:78715017-78715039 CCAAAGAGACCACCTCTTCTTAA No data
Right 1010673511 6:78715063-78715085 GATGCCTTTCACTCTCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010673511 Original CRISPR GATGCCTTTCACTCTCCCAA TGG Intergenic
No off target data available for this crispr