ID: 1010673514

View in Genome Browser
Species Human (GRCh38)
Location 6:78715076-78715098
Sequence CTCCCAATGGCAGGCATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010673510_1010673514 0 Left 1010673510 6:78715053-78715075 CCAGTTGGTAGATGCCTTTCACT No data
Right 1010673514 6:78715076-78715098 CTCCCAATGGCAGGCATTTCAGG No data
1010673508_1010673514 24 Left 1010673508 6:78715029-78715051 CCTCTTCTTAACACAGGTCAGTC No data
Right 1010673514 6:78715076-78715098 CTCCCAATGGCAGGCATTTCAGG No data
1010673507_1010673514 27 Left 1010673507 6:78715026-78715048 CCACCTCTTCTTAACACAGGTCA No data
Right 1010673514 6:78715076-78715098 CTCCCAATGGCAGGCATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010673514 Original CRISPR CTCCCAATGGCAGGCATTTC AGG Intergenic
No off target data available for this crispr