ID: 1010675911

View in Genome Browser
Species Human (GRCh38)
Location 6:78742746-78742768
Sequence GTTAATGCAAATTGAGGGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010675911_1010675921 16 Left 1010675911 6:78742746-78742768 CCGAACCCTCAATTTGCATTAAC No data
Right 1010675921 6:78742785-78742807 ATGCAATTGTAAGTGGGTATAGG No data
1010675911_1010675920 10 Left 1010675911 6:78742746-78742768 CCGAACCCTCAATTTGCATTAAC No data
Right 1010675920 6:78742779-78742801 ATTTGCATGCAATTGTAAGTGGG No data
1010675911_1010675919 9 Left 1010675911 6:78742746-78742768 CCGAACCCTCAATTTGCATTAAC No data
Right 1010675919 6:78742778-78742800 AATTTGCATGCAATTGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010675911 Original CRISPR GTTAATGCAAATTGAGGGTT CGG (reversed) Intergenic