ID: 1010675912

View in Genome Browser
Species Human (GRCh38)
Location 6:78742751-78742773
Sequence GGTGGGTTAATGCAAATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010675912_1010675919 4 Left 1010675912 6:78742751-78742773 CCCTCAATTTGCATTAACCCACC No data
Right 1010675919 6:78742778-78742800 AATTTGCATGCAATTGTAAGTGG No data
1010675912_1010675921 11 Left 1010675912 6:78742751-78742773 CCCTCAATTTGCATTAACCCACC No data
Right 1010675921 6:78742785-78742807 ATGCAATTGTAAGTGGGTATAGG No data
1010675912_1010675920 5 Left 1010675912 6:78742751-78742773 CCCTCAATTTGCATTAACCCACC No data
Right 1010675920 6:78742779-78742801 ATTTGCATGCAATTGTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010675912 Original CRISPR GGTGGGTTAATGCAAATTGA GGG (reversed) Intergenic