ID: 1010675914

View in Genome Browser
Species Human (GRCh38)
Location 6:78742768-78742790
Sequence TTGCATGCAAATTAAGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010675914_1010675921 -6 Left 1010675914 6:78742768-78742790 CCCACCCCTTAATTTGCATGCAA No data
Right 1010675921 6:78742785-78742807 ATGCAATTGTAAGTGGGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010675914 Original CRISPR TTGCATGCAAATTAAGGGGT GGG (reversed) Intergenic
No off target data available for this crispr