ID: 1010675915

View in Genome Browser
Species Human (GRCh38)
Location 6:78742769-78742791
Sequence ATTGCATGCAAATTAAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010675915_1010675921 -7 Left 1010675915 6:78742769-78742791 CCACCCCTTAATTTGCATGCAAT No data
Right 1010675921 6:78742785-78742807 ATGCAATTGTAAGTGGGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010675915 Original CRISPR ATTGCATGCAAATTAAGGGG TGG (reversed) Intergenic
No off target data available for this crispr