ID: 1010675920

View in Genome Browser
Species Human (GRCh38)
Location 6:78742779-78742801
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010675913_1010675920 4 Left 1010675913 6:78742752-78742774 CCTCAATTTGCATTAACCCACCC No data
Right 1010675920 6:78742779-78742801 ATTTGCATGCAATTGTAAGTGGG No data
1010675911_1010675920 10 Left 1010675911 6:78742746-78742768 CCGAACCCTCAATTTGCATTAAC No data
Right 1010675920 6:78742779-78742801 ATTTGCATGCAATTGTAAGTGGG No data
1010675912_1010675920 5 Left 1010675912 6:78742751-78742773 CCCTCAATTTGCATTAACCCACC No data
Right 1010675920 6:78742779-78742801 ATTTGCATGCAATTGTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010675920 Original CRISPR ATTTGCATGCAATTGTAAGT GGG Intergenic