ID: 1010675921

View in Genome Browser
Species Human (GRCh38)
Location 6:78742785-78742807
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010675914_1010675921 -6 Left 1010675914 6:78742768-78742790 CCCACCCCTTAATTTGCATGCAA No data
Right 1010675921 6:78742785-78742807 ATGCAATTGTAAGTGGGTATAGG No data
1010675913_1010675921 10 Left 1010675913 6:78742752-78742774 CCTCAATTTGCATTAACCCACCC No data
Right 1010675921 6:78742785-78742807 ATGCAATTGTAAGTGGGTATAGG No data
1010675911_1010675921 16 Left 1010675911 6:78742746-78742768 CCGAACCCTCAATTTGCATTAAC No data
Right 1010675921 6:78742785-78742807 ATGCAATTGTAAGTGGGTATAGG No data
1010675912_1010675921 11 Left 1010675912 6:78742751-78742773 CCCTCAATTTGCATTAACCCACC No data
Right 1010675921 6:78742785-78742807 ATGCAATTGTAAGTGGGTATAGG No data
1010675915_1010675921 -7 Left 1010675915 6:78742769-78742791 CCACCCCTTAATTTGCATGCAAT No data
Right 1010675921 6:78742785-78742807 ATGCAATTGTAAGTGGGTATAGG No data
1010675916_1010675921 -10 Left 1010675916 6:78742772-78742794 CCCCTTAATTTGCATGCAATTGT No data
Right 1010675921 6:78742785-78742807 ATGCAATTGTAAGTGGGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010675921 Original CRISPR ATGCAATTGTAAGTGGGTAT AGG Intergenic