ID: 1010678069 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:78767717-78767739 |
Sequence | CTTTAGCCATGGCGGGAGCT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1010678069_1010678079 | 13 | Left | 1010678069 | 6:78767717-78767739 | CCCAGCTCCCGCCATGGCTAAAG | No data | ||
Right | 1010678079 | 6:78767753-78767775 | ATCTCAGGCTCCTGCTCCAGAGG | No data | ||||
1010678069_1010678075 | -2 | Left | 1010678069 | 6:78767717-78767739 | CCCAGCTCCCGCCATGGCTAAAG | No data | ||
Right | 1010678075 | 6:78767738-78767760 | AGGAGCCCCAGATACATCTCAGG | No data | ||||
1010678069_1010678080 | 14 | Left | 1010678069 | 6:78767717-78767739 | CCCAGCTCCCGCCATGGCTAAAG | No data | ||
Right | 1010678080 | 6:78767754-78767776 | TCTCAGGCTCCTGCTCCAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1010678069 | Original CRISPR | CTTTAGCCATGGCGGGAGCT GGG (reversed) | Intergenic | ||
No off target data available for this crispr |