ID: 1010678069

View in Genome Browser
Species Human (GRCh38)
Location 6:78767717-78767739
Sequence CTTTAGCCATGGCGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010678069_1010678079 13 Left 1010678069 6:78767717-78767739 CCCAGCTCCCGCCATGGCTAAAG No data
Right 1010678079 6:78767753-78767775 ATCTCAGGCTCCTGCTCCAGAGG No data
1010678069_1010678075 -2 Left 1010678069 6:78767717-78767739 CCCAGCTCCCGCCATGGCTAAAG No data
Right 1010678075 6:78767738-78767760 AGGAGCCCCAGATACATCTCAGG No data
1010678069_1010678080 14 Left 1010678069 6:78767717-78767739 CCCAGCTCCCGCCATGGCTAAAG No data
Right 1010678080 6:78767754-78767776 TCTCAGGCTCCTGCTCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010678069 Original CRISPR CTTTAGCCATGGCGGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr