ID: 1010679279

View in Genome Browser
Species Human (GRCh38)
Location 6:78781026-78781048
Sequence CCTTTTCTTTAGCAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010679273_1010679279 1 Left 1010679273 6:78781002-78781024 CCACAGGCAGTGGAAAAACCAAC No data
Right 1010679279 6:78781026-78781048 CCTTTTCTTTAGCAGCTGGAAGG No data
1010679271_1010679279 15 Left 1010679271 6:78780988-78781010 CCAGCGTGCAGACTCCACAGGCA No data
Right 1010679279 6:78781026-78781048 CCTTTTCTTTAGCAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010679279 Original CRISPR CCTTTTCTTTAGCAGCTGGA AGG Intergenic
No off target data available for this crispr