ID: 1010682122

View in Genome Browser
Species Human (GRCh38)
Location 6:78809303-78809325
Sequence CCAGGGGCGCCCATTTCCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010682122_1010682128 17 Left 1010682122 6:78809303-78809325 CCTAGGGAAATGGGCGCCCCTGG No data
Right 1010682128 6:78809343-78809365 TGCTCCTGCACCAAACCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010682122 Original CRISPR CCAGGGGCGCCCATTTCCCT AGG (reversed) Intergenic
No off target data available for this crispr