ID: 1010693027

View in Genome Browser
Species Human (GRCh38)
Location 6:78933114-78933136
Sequence TTCAAAGGACAGGCTCTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010693027_1010693031 20 Left 1010693027 6:78933114-78933136 CCAATGAGAGCCTGTCCTTTGAA 0: 1
1: 1
2: 1
3: 16
4: 188
Right 1010693031 6:78933157-78933179 TAGCTATGAAAGTCCTAGATTGG 0: 6
1: 9
2: 13
3: 20
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010693027 Original CRISPR TTCAAAGGACAGGCTCTCAT TGG (reversed) Intronic
901078892 1:6572581-6572603 TTCCAAGGAAAGACTCTCATAGG - Intronic
901188684 1:7390783-7390805 TGCAGAGCACAGGCTCTCAATGG - Intronic
902092874 1:13917398-13917420 TTCAAAGGACAGGCTGACTCTGG + Intergenic
902761324 1:18582695-18582717 TTCGAAGGCCAGGAACTCATGGG - Intergenic
903775050 1:25787641-25787663 TTCCAAGGACAGGCCCCCAGGGG - Intergenic
904833066 1:33317859-33317881 TTCAAAGGAAATGCTCCCACTGG - Intronic
904904178 1:33882363-33882385 TTCAAAGGACAGGCTGTCAATGG + Intronic
905786381 1:40760991-40761013 TGCCAAGGGCAGGCTCTGATTGG + Intronic
906028258 1:42694562-42694584 TTCATAGGAAGGGCTGTCATAGG + Intronic
906708098 1:47909613-47909635 TTTAAACGACCGGATCTCATGGG + Intronic
909468443 1:76000635-76000657 TCCAAAGTACAGAGTCTCATAGG + Intergenic
911352371 1:96769543-96769565 TTCAAATGCCAGGCTTTCAAAGG - Intronic
911904629 1:103550972-103550994 ATGAAAGGACAAGCTTTCATTGG + Exonic
916058533 1:161083885-161083907 ATCAGAGGCCAGGCTCACATAGG - Intronic
917386170 1:174477567-174477589 TTCAAAGTCAAGGTTCTCATGGG + Intronic
921570816 1:216776260-216776282 TGCAAAGGACAGGGTATTATGGG - Intronic
922953526 1:229579425-229579447 TTCACAGGACAGCCATTCATGGG + Intergenic
924061299 1:240177501-240177523 GTCAAAGGACAGGCTGTACTTGG - Intronic
924109849 1:240688069-240688091 TTCAAGTGACTGGCACTCATTGG + Intergenic
1062969264 10:1633769-1633791 TTCAGGGGACAGGCTGTCCTGGG + Intronic
1065885459 10:30073008-30073030 TTACAGGGACAGGCTCTCTTAGG + Intronic
1066514772 10:36145828-36145850 TTCAAAGGCCAGCCTCTCAATGG + Intergenic
1067534802 10:47101231-47101253 GTCACAGGGCAGGCTCTCAGGGG + Intergenic
1069319766 10:67154468-67154490 TTCAAAGGCAAAGCTCTTATTGG - Intronic
1070472187 10:76792190-76792212 TTGATAGGACAGGCTTTGATTGG - Intergenic
1071342152 10:84659129-84659151 GTCAAAGGACAGCCTCGCAATGG - Intergenic
1071901424 10:90124238-90124260 TTCAAAGTATGGTCTCTCATTGG + Intergenic
1073268262 10:102241295-102241317 TTCTAAGGACAGGGGCTCATGGG - Intronic
1074335472 10:112569897-112569919 TTCAAAGCACAGGTTCTTCTAGG - Intronic
1074353306 10:112758994-112759016 TTCACAGCACAGGGTGTCATTGG - Intronic
1078103702 11:8345319-8345341 ATTAAAGGCCAGGCTCTCTTAGG + Intergenic
1078663673 11:13306992-13307014 TTTAAGGGAAAGGCTCTGATTGG + Intronic
1078696333 11:13635851-13635873 TCCAAAGAAGAGGCTCTCAGGGG + Intergenic
1080102198 11:28472504-28472526 TTCAAAAGACAGACTCCCAGAGG + Intergenic
1080555521 11:33413074-33413096 TTTTAAGTACAGGATCTCATGGG - Intergenic
1081280503 11:41203873-41203895 TCCAGAAGACAGGCTCCCATAGG - Intronic
1082102169 11:48181675-48181697 AGCAAAAGACAGGATCTCATTGG - Intergenic
1082960715 11:58916407-58916429 GTAAAAGGCCAGGCTCTTATGGG - Intronic
1082980666 11:59117502-59117524 GTGAAAGGCCAGGCTCTTATGGG - Intronic
1083029402 11:59578230-59578252 TTCAAAGTACAGCCAGTCATTGG - Exonic
1083482469 11:62958444-62958466 TTCCTAGAACAGGCTCTGATTGG - Intronic
1084101673 11:66953865-66953887 TACAAATGACGGACTCTCATAGG - Intronic
1085253788 11:75160545-75160567 TTCAAAGCAAAGGCTCCCAGAGG - Intronic
1090263318 11:125338358-125338380 CACAAAGCACAGGCTCTCACTGG + Intronic
1092845025 12:12576459-12576481 TTCTTAGGAAAGGCTCTCCTTGG + Intergenic
1093832642 12:23782957-23782979 TTCAGAGGAAAGGCTCTCAAAGG - Intronic
1095159309 12:38898162-38898184 TTTAAAGGACAGGATCCCACAGG - Intronic
1096697010 12:53355795-53355817 TTCTTAAGACAGGGTCTCATTGG - Intergenic
1096729117 12:53592544-53592566 TTTAAAGGACAAGCTCTCTGTGG + Intronic
1096953554 12:55502020-55502042 TGCAAAGGACATAATCTCATTGG - Intergenic
1100633165 12:96408309-96408331 TTCCAAGGAAAGACTCTGATTGG + Intergenic
1106918344 13:34539230-34539252 TTCAAAGGACAATCTCTCTTGGG + Intergenic
1107686582 13:42906489-42906511 TTGAGAGAACAGGCTCTCCTGGG - Intronic
1109585663 13:64399211-64399233 TTCTTAAGACAGGCGCTCATTGG + Intergenic
1111020618 13:82444572-82444594 TTCAAGGGACTGATTCTCATTGG - Intergenic
1114465473 14:22919235-22919257 TCCAAAGTACAGGTTCTCATTGG + Intergenic
1114585883 14:23813252-23813274 TACAAAGGACATGAACTCATGGG - Intergenic
1116866000 14:50032133-50032155 TTCCCAGGAGAGGCTCTGATTGG - Intergenic
1118924993 14:70184133-70184155 TTCAATGTACAGACTCTCATGGG - Intronic
1121927306 14:97939536-97939558 GACAAAATACAGGCTCTCATGGG + Intronic
1122864603 14:104597879-104597901 TTAAAAGGCCAGGCTGTGATTGG + Intronic
1124142325 15:27088376-27088398 TTCAGAGGGCAGGCGCTCGTGGG + Intronic
1125684369 15:41554918-41554940 TTCTAAGGACAGGAACTCCTGGG + Intergenic
1125832449 15:42726402-42726424 TTCACAGGACGTGCTCTCCTTGG - Exonic
1127269232 15:57385860-57385882 TTCAAAGGACAGTCCCCCACGGG + Intronic
1127787997 15:62373071-62373093 TCCTAGGGACAGGCCCTCATGGG + Intergenic
1128646036 15:69379646-69379668 TTCAAGGGCCAGGCTCCCTTTGG - Intronic
1128733317 15:70035151-70035173 TCCAAAGGACAGGCACCCACGGG - Intergenic
1129315127 15:74738022-74738044 TGCAAATGACAGGATCTCATTGG - Intergenic
1135388195 16:22063706-22063728 TTCACAGGAGAGGCTCCCCTGGG - Intronic
1138160249 16:54746563-54746585 TTCAAGGAGCAGGCTCTCCTGGG - Intergenic
1140284318 16:73587114-73587136 TTCGAAGAACTGGCTCTCAAAGG + Intergenic
1141014997 16:80440917-80440939 TTCAAAGGACAGAATCCCAGTGG + Intergenic
1141834681 16:86530959-86530981 TTGAAAGGACATTTTCTCATTGG - Exonic
1143387280 17:6538736-6538758 TTCAAAGGACAGTCTCTGCCAGG - Intronic
1143581933 17:7832856-7832878 TTCAGTGGACAGCCTCTCCTGGG + Exonic
1143740790 17:8952552-8952574 TTTAAAGGCCAGACACTCATTGG + Intronic
1146464746 17:33077427-33077449 TTCAAAGGGTATTCTCTCATTGG + Intronic
1150641515 17:66952928-66952950 CCCAAAGGCCAGGCTCTCCTGGG + Intergenic
1151471591 17:74321747-74321769 TTCCAGGGAAAGGCTCTGATTGG + Intergenic
1151686995 17:75653244-75653266 TTCAAAGTACAGGCTCACCTTGG + Intronic
1154227672 18:12522157-12522179 TGCAAAGGACAAGCTCTTAAAGG + Intronic
1156727818 18:40150182-40150204 TTCAAAGGGCAGTTTCTCACTGG + Intergenic
1156825866 18:41429627-41429649 CTCTAAGGAGAGGCTGTCATTGG - Intergenic
1160920345 19:1516613-1516635 GTCCCAGGGCAGGCTCTCATTGG - Intergenic
1162179516 19:8858402-8858424 ATCAAAGGACATGCTCTTCTAGG + Intronic
1164656323 19:29924628-29924650 CTCACAGGACAGCCTCTGATTGG - Intronic
927014365 2:18942221-18942243 TTCAAAGGAAATGTTCCCATAGG - Intergenic
933194585 2:79373917-79373939 CTCCAAGGACAGGCTTCCATTGG - Intronic
934150649 2:89144712-89144734 GTCAATGGACACACTCTCATGGG - Intergenic
934216626 2:90037316-90037338 GTCAATGGACACACTCTCATGGG + Intergenic
937110069 2:119359011-119359033 TTCAAAGGACAGGCTGACTGTGG + Intronic
937288017 2:120765306-120765328 TTCTAAGGACAGGGTCTCCCTGG + Intronic
939030114 2:137063833-137063855 TGCAGATGACAGGATCTCATTGG + Intronic
939192258 2:138930777-138930799 TTCAAACGACCAGATCTCATGGG + Intergenic
939737884 2:145872129-145872151 TTCCAAGGATAGGCCCTCAAGGG - Intergenic
940189137 2:151020177-151020199 TGCAAAGGACATGATCTCATTGG + Intronic
940895838 2:159081290-159081312 TTGAAAGGACAGTCTCACTTTGG - Intronic
942192377 2:173483001-173483023 TGTAAATGACAGGATCTCATAGG + Intergenic
945914444 2:215688169-215688191 TTCAAAGGACAGGAACTGCTGGG - Intergenic
946437197 2:219665105-219665127 TCCAGAGGACAGGCTGTCATCGG + Intergenic
947671707 2:231941060-231941082 AGCAAAGGCCAGGCTCTCACGGG - Intergenic
1168892046 20:1300944-1300966 CCCACAGGACAGGCCCTCATGGG - Intronic
1170174787 20:13456948-13456970 TGCAAAGGACATGAACTCATAGG - Intronic
1171238393 20:23546253-23546275 CTCCCAGGACAGGGTCTCATGGG - Intergenic
1171243272 20:23588179-23588201 CTCCCAGGACAGGGTCTCATGGG + Intergenic
1173557108 20:43974018-43974040 TTCAGAGACCAGGCTCTCAGTGG - Intronic
1174375217 20:50122057-50122079 GTCCCAGGGCAGGCTCTCATTGG - Intronic
1174704943 20:52645750-52645772 TTCTAAAGTCAGGCTCTCCTGGG + Intergenic
1175244202 20:57571843-57571865 TTCAAAGGACAGAGTCTCAGTGG - Intergenic
1177070894 21:16506257-16506279 TTCAAAGTACATGCTCTCAGTGG - Intergenic
1177771036 21:25516081-25516103 TTCAAAGTACAGGGACTCAATGG - Intergenic
1178053914 21:28777928-28777950 TTTAAAGTAAAGGTTCTCATGGG - Intergenic
1182515977 22:30859363-30859385 GTCAAAGGAAATGCTCACATAGG + Intronic
1183299701 22:37052760-37052782 TTCAGGGGACAGCCTCTCAGAGG + Intronic
949381398 3:3449716-3449738 ATCTCAGGAAAGGCTCTCATTGG - Intergenic
950627651 3:14259908-14259930 ATCTCAGGAAAGGCTCTCATTGG + Intergenic
952847985 3:37704434-37704456 GTCAAAGGCAAAGCTCTCATAGG - Intronic
953168428 3:40485889-40485911 TTCAAAGGTCAGTCTCCCAAAGG + Intronic
956152175 3:66255159-66255181 TTAAAGAGACAGGATCTCATAGG + Intronic
956262394 3:67358336-67358358 TTCAAAGGACAGACTGTGGTTGG - Intergenic
956645690 3:71453490-71453512 ATCAAAGGATAGGCTGTAATAGG + Intronic
958920441 3:100099788-100099810 TTCAAATGTCTGGCTCTCCTTGG - Intronic
960356016 3:116654544-116654566 TCCAAAGCACTGGCTCTCTTTGG - Intronic
960382769 3:116984940-116984962 TTCAAAGGACAGGCTCTCTTAGG + Intronic
961507242 3:127378185-127378207 TTCTCAGGACAGGCTCTCAGGGG + Intergenic
962994936 3:140617222-140617244 TACAAAGGACATACTCTCTTGGG + Intergenic
963494723 3:146044908-146044930 TTTAGAGGAGAGGGTCTCATGGG - Intergenic
964920155 3:161886094-161886116 TTTAAATGACAAGATCTCATGGG - Intergenic
968228448 3:196990416-196990438 TTCTCAGGACAGCCTCTCACAGG + Intronic
971829399 4:31671199-31671221 TACAAAGGACATGAACTCATCGG - Intergenic
973900730 4:55467963-55467985 TTAAAAGTCCAGGCTCTCAAGGG - Intronic
974830716 4:67185832-67185854 TTGCAAGGAGATGCTCTCATGGG - Intergenic
977238014 4:94532333-94532355 TTTAAAGGAAAGGCTAGCATGGG + Intronic
978207588 4:106096730-106096752 TTCAAGGGAGAGAATCTCATTGG - Intronic
979519918 4:121654119-121654141 TTCAAACAACCAGCTCTCATGGG - Intergenic
979905761 4:126289383-126289405 TGCAAATGACAGGATCTAATAGG - Intergenic
979960697 4:127017770-127017792 TGCAAAGGACATGCTGTCCTTGG + Intergenic
982845481 4:160246993-160247015 CACAAAGGACAGAATCTCATGGG - Intergenic
983343574 4:166498516-166498538 TTCAGAGTTCAGGCTCTCAAAGG - Intergenic
983535067 4:168848694-168848716 TTGAAAGGAAAGGCTTACATTGG + Intronic
985009254 4:185565917-185565939 GTCACAGGACAGGCAGTCATAGG - Intergenic
988563493 5:32301472-32301494 TTCCAAGGACAGGGACACATTGG + Intronic
989200213 5:38755697-38755719 ACAAAAGTACAGGCTCTCATGGG + Intergenic
994925680 5:106114675-106114697 TGCAAAGGATAGGCTCCCACTGG - Intergenic
996807386 5:127471909-127471931 TTCAAAGGACAGGCTGACTCTGG - Intergenic
998159638 5:139806190-139806212 TGCAAATGACAGGCTGGCATTGG - Intronic
998506412 5:142675768-142675790 ATAAAAGGACAGGCTATTATAGG - Intronic
999585721 5:153087696-153087718 TTCTAAGGACACCCTTTCATTGG + Intergenic
999645399 5:153712419-153712441 TGCAAAGGTCAGGCTATCGTTGG - Intronic
1000141283 5:158405602-158405624 TTCAAAGGATGGGCTGCCATGGG - Intergenic
1000296009 5:159914216-159914238 TTAAAAGGAGAGGCTGTCATTGG - Intergenic
1001738374 5:174026941-174026963 TTCTGAGGAAAGGCTCTGATCGG - Intergenic
1004452972 6:15764441-15764463 TTTAAAGAAGAGGATCTCATGGG - Intergenic
1007034213 6:38658105-38658127 TTTAAGAGACAGGGTCTCATCGG + Intergenic
1010693027 6:78933114-78933136 TTCAAAGGACAGGCTCTCATTGG - Intronic
1012836672 6:104278226-104278248 TTCAAAGGACAGGTTGACAGAGG - Intergenic
1014748668 6:125230633-125230655 TACAAAGGACATCTTCTCATAGG - Intronic
1016442120 6:144095135-144095157 TCCAAAGGACCGGCTCTCCATGG - Exonic
1017233429 6:152096193-152096215 CTAAAAGGACAGGTACTCATGGG + Intronic
1018207937 6:161453168-161453190 TTCAAGGCTCAGGCCCTCATTGG - Intronic
1019624044 7:2006805-2006827 TTTGGGGGACAGGCTCTCATGGG + Intronic
1020541573 7:9465359-9465381 TTCAAAGGACAGCAACTCAAAGG - Intergenic
1021329807 7:19322428-19322450 TTCAAAGTACAAGCTTTCCTAGG + Intergenic
1025197530 7:56944349-56944371 TCCAAAGCACAGGCTGCCATGGG - Intergenic
1025674417 7:63632590-63632612 TCCAAAGCACAGGCTGCCATGGG + Intergenic
1026617944 7:71923845-71923867 TTCAAAGGCCATGCTAACATGGG - Intronic
1027779346 7:82503323-82503345 TACAGAGGTCAGGCTTTCATTGG - Intergenic
1030534816 7:110752960-110752982 TTTAAAGGAAAGAATCTCATAGG + Intronic
1030592272 7:111496460-111496482 TTCAAAGGCCAATCTCTCCTGGG - Intronic
1031805634 7:126303472-126303494 TTGGAAGGACAAGCTCTCCTGGG + Intergenic
1033679796 7:143583270-143583292 TTTAAAGCACCCGCTCTCATGGG + Intergenic
1033692039 7:143746173-143746195 TTTAAAGCACCCGCTCTCATGGG - Intergenic
1038643720 8:29347523-29347545 TTCCAAGGGCAGGCTCCCTTTGG + Intronic
1042792479 8:72623865-72623887 CCCCAAAGACAGGCTCTCATTGG + Intronic
1045415654 8:101964410-101964432 TTCAAAGGCAAGGTTCTGATTGG + Intronic
1050909159 9:11045102-11045124 TTCATAAGACAGGTTCCCATTGG - Intergenic
1051997778 9:23238768-23238790 TTTTAAGGACTGGCTTTCATAGG - Intergenic
1053270707 9:36747564-36747586 TCCCAAGGACAGACTCTGATCGG - Intergenic
1053377230 9:37617910-37617932 TGCAAAGAATGGGCTCTCATGGG - Intronic
1055559046 9:77504323-77504345 TTCACAAGACCTGCTCTCATAGG + Intronic
1057514974 9:95713143-95713165 TTCAAAACAGAGGCTCTGATTGG + Intergenic
1058091710 9:100813424-100813446 TTCAAAGGACTGCCACTCATTGG - Intergenic
1058178653 9:101769140-101769162 TTCAAAGCACAGGCTTAGATAGG - Intergenic
1059542628 9:115145008-115145030 TTCAAACTCCAGGCTCTCAAGGG + Intronic
1059771805 9:117433825-117433847 TTCAAAGGGCAAGCTGTGATGGG - Intergenic
1060111536 9:120910078-120910100 GCCAGAGGACATGCTCTCATGGG - Intronic
1185556037 X:1022041-1022063 TGCAAAGGATATGATCTCATGGG - Intergenic
1187429411 X:19208411-19208433 TACAAAGGACATGAACTCATTGG - Intergenic
1187538395 X:20165426-20165448 TGGAAAGGCCAGGATCTCATGGG - Intronic
1188229194 X:27640095-27640117 TACAAAGGACATGAACTCATTGG - Intronic
1188410041 X:29860673-29860695 TGCAAAGGACATGAACTCATCGG + Intronic
1188589349 X:31815011-31815033 TTCACAGCACTGGATCTCATTGG + Intronic
1188758389 X:33993922-33993944 TGCAAAGGACATGATTTCATTGG + Intergenic
1188831959 X:34909364-34909386 TGCAAATTACAGGATCTCATTGG + Intergenic
1189552946 X:42112611-42112633 TGCAAAGGACATGAACTCATTGG + Intergenic
1190112519 X:47603083-47603105 TTCAAAACACAGGTACTCATGGG + Intronic
1190426926 X:50342218-50342240 TGCCAAGTACAGGGTCTCATGGG - Exonic
1191232191 X:58104742-58104764 TTCTAATGACAGACGCTCATGGG + Intergenic
1191853457 X:65603435-65603457 ATGAAAGGACAGGCTCAGATAGG + Intronic
1192958437 X:76099302-76099324 TACAAAGGACATGAACTCATTGG - Intergenic
1193701737 X:84771117-84771139 TTCACAGGACAGGCAGTCTTAGG - Intergenic
1193843422 X:86438197-86438219 TGCAAAGGACATGATCTCGTAGG + Intronic
1194577937 X:95637415-95637437 TACAGAGGAGAGGCTCTCAGAGG + Intergenic
1195390418 X:104356403-104356425 TTCAAAGAACAGACTTCCATTGG + Intergenic
1195522399 X:105846186-105846208 TTCACAGGCCAGGCTATCACTGG + Intronic
1196331700 X:114478231-114478253 TGCAAATGACAGGATTTCATTGG + Intergenic