ID: 1010694652

View in Genome Browser
Species Human (GRCh38)
Location 6:78955849-78955871
Sequence AAAGCTCTACATAGAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010694652 Original CRISPR AAAGCTCTACATAGAGTGGA GGG (reversed) Intronic
900034321 1:394294-394316 AAAGCACTACATTGGGTGGGGGG + Intergenic
900055155 1:624186-624208 AAAGCACTACATTGGGTGGGGGG + Intergenic
903899404 1:26632410-26632432 GAAGTTGTACATAGAGGGGAAGG - Intergenic
904364992 1:30004843-30004865 AAAGCTCTACAGACACTGGAGGG + Intergenic
904608498 1:31712237-31712259 AAAGCTAAACATTGAGGGGAGGG - Intergenic
905645502 1:39622530-39622552 AAAGCTCTCAATAGAGTGCCTGG - Intergenic
905899451 1:41571648-41571670 AAAGAACTACAGAGTGTGGAGGG + Intronic
908007375 1:59740747-59740769 GAAGCTAAACATAGAGTGAATGG - Intronic
911346021 1:96697513-96697535 ACAGCAATACATGGAGTGGAAGG - Intergenic
913484505 1:119321684-119321706 AAATATCTACAGAGAGTAGATGG + Intergenic
916071914 1:161175388-161175410 ACAGCTCTACAAAGGCTGGAAGG + Intronic
919649210 1:200129082-200129104 AAAGCTCCCTATAGAGTGGTTGG + Intronic
920689813 1:208137350-208137372 AAATCTATACACAGGGTGGATGG - Intronic
921262591 1:213396966-213396988 AAGCCTCTACAAAGAGAGGAAGG - Intergenic
923566975 1:235083645-235083667 AAAGCTCTAGAGAGACAGGATGG + Intergenic
924337882 1:243001344-243001366 AAAGCACTACATTGGGTGGGGGG + Intergenic
1065953966 10:30677230-30677252 AAAGCCCTACAGAGAGGAGATGG - Intergenic
1068396507 10:56468792-56468814 AATGCTCTAGATAGAGTGAACGG - Intergenic
1068973092 10:62979719-62979741 AAGCCTCTACATGGAATGGATGG + Intergenic
1072524310 10:96258062-96258084 AAGGCTTTAGAAAGAGTGGAGGG - Intronic
1074653730 10:115558271-115558293 AAAGCACTCCACAGAGTGGGAGG + Intronic
1080162174 11:29190134-29190156 AAAGTTCTAGTTAGTGTGGATGG - Intergenic
1080697507 11:34615604-34615626 CAAGCTCTACACTTAGTGGAGGG + Intergenic
1080789977 11:35513935-35513957 ACAGCTTTACATGGACTGGAGGG - Intronic
1082927078 11:58560616-58560638 AAAGCTCTGTATAGAGTGTCAGG - Intronic
1083542658 11:63524361-63524383 AAAGCTCTCCATAGTGAAGAGGG + Intergenic
1087873494 11:103327163-103327185 AAAACACTACCGAGAGTGGATGG - Intronic
1090754658 11:129779298-129779320 AAAGCTCTCCACAGAGGAGAGGG + Intergenic
1091875073 12:3926892-3926914 TAATCTCAAGATAGAGTGGAGGG - Intergenic
1092783571 12:12008664-12008686 AAAACTCTACAGAGAGGGCATGG + Intergenic
1093087934 12:14887205-14887227 AAAGCTCTTCACAGGATGGAGGG - Intronic
1093748704 12:22773292-22773314 AAAATTCTACATACAGTTGAGGG - Intergenic
1094335953 12:29353863-29353885 AAAACTCTGCATAGGGAGGATGG + Intronic
1097624563 12:61984009-61984031 ACAGCTTTACATAGGGTGGTAGG - Intronic
1101281783 12:103264945-103264967 AAAGTGCTATATAGAGTGGGTGG + Intronic
1109338968 13:61029601-61029623 AATGCTCTCAATAGAGTGGGAGG + Intergenic
1111667718 13:91290885-91290907 AAATTTCTACAGAAAGTGGAAGG - Intergenic
1116307631 14:43278628-43278650 AAAGCTCTTAATAGAGTATAAGG - Intergenic
1116393795 14:44423737-44423759 ACAGTTCTGCATAGTGTGGAAGG + Intergenic
1121186190 14:91972161-91972183 AAAGATCTGCCTAGAGCGGACGG - Intronic
1124791133 15:32728336-32728358 AAAGCTCTGCATAAAGAGCAGGG + Intronic
1126048875 15:44669167-44669189 AGAGCTCTGCATAGAGGAGAGGG + Intronic
1126685225 15:51242530-51242552 AAAGCACAGCACAGAGTGGAAGG + Intronic
1129256460 15:74336733-74336755 CAAGCTCTACATGGAATAGATGG - Intergenic
1131762260 15:95637300-95637322 AAAGCTCTGAATAGAGTCAAAGG + Intergenic
1143686581 17:8522260-8522282 AAAGCTCTTCATACAGTGTCAGG - Intronic
1144224057 17:13127598-13127620 AAAGCACATCATAGAGTCGAAGG - Intergenic
1144356409 17:14451097-14451119 AAAGCTGTAGATAGAGAGCAGGG + Intergenic
1146563342 17:33890631-33890653 CCAACTCTACATAGAATGGACGG - Intronic
1147507909 17:41038700-41038722 AAAGCTCTACAACCAGTGGCCGG - Intergenic
1148564940 17:48627073-48627095 AAATCTCTACAAAGAGTGCAAGG - Intronic
1150455229 17:65301913-65301935 AAAGCACAACAGAGTGTGGAAGG + Intergenic
1151033929 17:70776047-70776069 AAATTTCAACATAGAGGGGAAGG + Intergenic
1152963468 18:95186-95208 AAAGCTCAACACAGAATGAAAGG - Intergenic
1153154533 18:2133494-2133516 AAAGCCCTACATGGAATTGAAGG + Intergenic
1154489186 18:14906245-14906267 AAATCAGGACATAGAGTGGAAGG - Intergenic
1156109004 18:33700737-33700759 AAAGCTCAATCTATAGTGGATGG - Intronic
1159538353 18:69743887-69743909 AAAGCTCTGTATACAGTGTAAGG + Intronic
1161539877 19:4844125-4844147 AAGGCTTGAGATAGAGTGGAGGG + Intronic
1162180658 19:8866613-8866635 AAAGCTTAACCCAGAGTGGATGG - Intronic
1162553525 19:11372173-11372195 AAAGACCTAAAAAGAGTGGAGGG + Intergenic
1164676492 19:30104893-30104915 AGAGCTCTACATGGTGGGGACGG + Intergenic
1166318373 19:42001635-42001657 AAGGCTCAACAAAGGGTGGAGGG - Intronic
1167746772 19:51356174-51356196 AAAGCTCTCCACAGAGGAGAGGG - Exonic
925952258 2:8926391-8926413 AAAACTCAACATAGAGTACAAGG + Intronic
927338116 2:21948892-21948914 TAAGCTCTAGCTATAGTGGAGGG - Intergenic
928797431 2:35039597-35039619 ACAGTTCTACATAGCTTGGAAGG - Intergenic
933024665 2:77241387-77241409 AAATGTTTACATAGAGTGCAAGG - Intronic
934913941 2:98282929-98282951 GAAGCTCTTCACAGAGTGAATGG + Intronic
935921246 2:108017883-108017905 AAGGCTCAACATAGAGTAGGAGG - Intergenic
936079079 2:109419932-109419954 CAAGCTCTCCATAGCATGGAAGG + Intronic
938452166 2:131431139-131431161 AAAGAACTACCCAGAGTGGATGG + Intergenic
939800028 2:146697128-146697150 AAAGCTCTACATGGTGGAGAGGG + Intergenic
946287697 2:218717649-218717671 AAAGCCCTACTAAGAGAGGAAGG - Intronic
947679884 2:232020830-232020852 AAAGCTCTTCAAAGAGTGTGTGG + Intronic
1170136386 20:13078843-13078865 AAAACTCTATTTCGAGTGGAGGG - Intronic
1172081940 20:32348856-32348878 AGAGCTTTCCTTAGAGTGGAAGG - Intergenic
1173830179 20:46078707-46078729 AAAGCTCTTCTTTGAGAGGAGGG + Intronic
1177564536 21:22801891-22801913 AGAGATCTATATAGAGAGGATGG + Intergenic
950725287 3:14913334-14913356 ATAGCTCTAGATAGAGAGGGAGG - Intronic
955923770 3:63985784-63985806 AAAGTTCTACAATGAGTGAATGG - Intronic
956236790 3:67080669-67080691 AAAGCTTGGCATAAAGTGGATGG + Intergenic
957523304 3:81348998-81349020 AAACCTATACATAGAGCGCATGG - Intergenic
959456072 3:106563250-106563272 AAAGCTCTCCATAATGTGGATGG + Intergenic
960068620 3:113403258-113403280 AAAGTGCTACACAGAGTGGGTGG + Intronic
963768980 3:149369328-149369350 AAATATTTACTTAGAGTGGAAGG - Exonic
966424722 3:179768771-179768793 AAAGTTCTATATAGAGGGGTTGG + Intronic
966591664 3:181690565-181690587 AAAGGTCTACAAAGAGTTAAAGG - Intergenic
969905932 4:10396066-10396088 CAACCTCTACATAGAGAGGGTGG + Intergenic
977592271 4:98840518-98840540 AAAGCCCAACAAAAAGTGGAAGG - Intergenic
979239255 4:118433988-118434010 AAAGCACTACATTGGGTGGGGGG - Intergenic
979935218 4:126685306-126685328 ATAGCTCAAAATAGAGTGGTGGG - Intergenic
980072996 4:128263567-128263589 AAAGCTCTACATTGGGGGGCAGG - Intergenic
980442341 4:132865732-132865754 AAAGCTGGACATATAGTTGATGG + Intergenic
983250957 4:165345924-165345946 ATAGCTCTCCAGAGAGAGGAGGG - Intergenic
984203056 4:176751308-176751330 ATAGCTCTTTATAGAATGGATGG + Intronic
986476541 5:8139656-8139678 AAATCTATACAAACAGTGGAAGG - Intergenic
988414694 5:30931357-30931379 AATGCTCTGCATAAAGGGGAAGG + Intergenic
994700856 5:103133086-103133108 ATCTTTCTACATAGAGTGGATGG + Intronic
997487665 5:134245308-134245330 AAAGCTCTCCATCTAGTAGATGG - Intergenic
998728556 5:145047168-145047190 AAAGCTCTAATTAGTGTGGTAGG + Intergenic
1000373044 5:160555421-160555443 AAGACTCTAGATGGAGTGGAGGG - Intergenic
1002385757 5:178865692-178865714 AAAGCTCTAAATATAGTGTCTGG + Intronic
1002739499 5:181424574-181424596 AAAGCACTACATTGGGTGGGGGG - Intergenic
1007333282 6:41131499-41131521 AAAACTGTATATAGAGTGGCTGG - Intergenic
1010354611 6:74917229-74917251 AAAGTTCTACTAAGAGGGGAAGG - Intergenic
1010694652 6:78955849-78955871 AAAGCTCTACATAGAGTGGAGGG - Intronic
1012966156 6:105675674-105675696 AAAACTCTAAATAAAGTGGAGGG + Intergenic
1016490403 6:144594226-144594248 AAAGCTCTACATAGATGTTAAGG - Intronic
1016684764 6:146868528-146868550 AAAGCAATACAGAGAGTGAATGG - Intergenic
1017266622 6:152453585-152453607 AAAGCTCCACAAACAATGGAAGG - Exonic
1018628942 6:165805586-165805608 ATACCTGTACATAGAGTTGAAGG - Intronic
1019244615 6:170700145-170700167 AAAGCACTACATTGGGTGGGGGG - Intergenic
1019349715 7:548927-548949 ACAGGGCTACAGAGAGTGGACGG + Intergenic
1023335153 7:39161267-39161289 AAAGTACTACATGAAGTGGAAGG - Intronic
1023586441 7:41735739-41735761 AAATCTATACATAGAGCAGATGG - Intergenic
1028171111 7:87597682-87597704 AAAAGACTCCATAGAGTGGAGGG - Intronic
1028629157 7:92914724-92914746 AAAGCTCTTTATACAGAGGATGG + Intergenic
1030977143 7:116140753-116140775 AATGCACTACAGAGTGTGGAGGG - Intronic
1031925911 7:127638330-127638352 AAAGTTCTACTTAGAGTGCCTGG - Intergenic
1035503511 8:108031-108053 AAAGCACTACATTGGGTGGGGGG + Intergenic
1038262060 8:26004011-26004033 AAAGTCCTCCACAGAGTGGAAGG - Intronic
1044574076 8:93749725-93749747 GAAGCTCTACAAAGATAGGAAGG - Intergenic
1045964525 8:108009466-108009488 AAGGCTCTATATAGAATGGGGGG + Intronic
1046336906 8:112802602-112802624 AAAGCTCTCCATAAAATGGAGGG - Intronic
1047281113 8:123446524-123446546 AAAGCTCTCCAGAGGGAGGAGGG - Intronic
1047654218 8:126958987-126959009 AAAGCACTAAATTGAGTGAAAGG + Intergenic
1049233851 8:141498223-141498245 AAAGCTCCAAAAAGAGTAGAGGG + Intergenic
1051010919 9:12413086-12413108 AAAGCTCCAGTTAGACTGGAAGG + Intergenic
1051799457 9:20915586-20915608 AAGGATCTAGAGAGAGTGGAAGG + Intronic
1053431474 9:38044508-38044530 AAAGCTCTCCATAGAGGAGGTGG + Intronic
1055268948 9:74533962-74533984 AAATCTCTCCAAATAGTGGATGG + Intronic
1056285207 9:85080521-85080543 AAAGATGTTCAGAGAGTGGATGG + Intergenic
1058061365 9:100500089-100500111 AGAGCTCTGCATAGCATGGAAGG + Intronic
1058337297 9:103846625-103846647 AAACCTCTACATAGAGAGAGCGG + Intergenic
1061281543 9:129600553-129600575 AAAGCTCTAAATCAAGTGCAGGG - Intergenic
1061830173 9:133286718-133286740 AAAGCTCTCCATCGAGTTCAGGG + Intergenic
1203604805 Un_KI270748v1:49375-49397 AAAGCACTACATTGGGTGGGGGG - Intergenic
1186809140 X:13170053-13170075 AAAGCTCTAGAAAGAGGGAATGG - Intergenic
1191041437 X:56085154-56085176 AAAAGTCTATATAGAGTGGCAGG - Intergenic
1192122886 X:68473845-68473867 AAAGATCTAAATAAAGTGAAAGG + Intergenic
1201694732 Y:16812245-16812267 AAAGCTCTACATACACAGGCAGG - Intergenic
1202386996 Y:24335771-24335793 AAAGCACTACATTGGGTGGGGGG - Intergenic
1202483790 Y:25334357-25334379 AAAGCACTACATTGGGTGGGGGG + Intergenic