ID: 1010700150

View in Genome Browser
Species Human (GRCh38)
Location 6:79034892-79034914
Sequence CTAATATTCTTTGAGTGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010700146_1010700150 27 Left 1010700146 6:79034842-79034864 CCCCAAAGAGTTAAAGAAATCAA 0: 2
1: 15
2: 29
3: 83
4: 673
Right 1010700150 6:79034892-79034914 CTAATATTCTTTGAGTGTGCGGG No data
1010700147_1010700150 26 Left 1010700147 6:79034843-79034865 CCCAAAGAGTTAAAGAAATCAAC 0: 1
1: 4
2: 20
3: 74
4: 412
Right 1010700150 6:79034892-79034914 CTAATATTCTTTGAGTGTGCGGG No data
1010700148_1010700150 25 Left 1010700148 6:79034844-79034866 CCAAAGAGTTAAAGAAATCAACG 0: 1
1: 3
2: 14
3: 43
4: 239
Right 1010700150 6:79034892-79034914 CTAATATTCTTTGAGTGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010700150 Original CRISPR CTAATATTCTTTGAGTGTGC GGG Intronic
No off target data available for this crispr